ID: 1180869299

View in Genome Browser
Species Human (GRCh38)
Location 22:19137404-19137426
Sequence ACGAGTCCCCGATGATGACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 30}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180869299_1180869301 14 Left 1180869299 22:19137404-19137426 CCAGGTCATCATCGGGGACTCGT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1180869301 22:19137441-19137463 AAAGAGCCCAAAACCACCTCAGG 0: 1
1: 0
2: 2
3: 10
4: 174
1180869299_1180869304 21 Left 1180869299 22:19137404-19137426 CCAGGTCATCATCGGGGACTCGT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1180869304 22:19137448-19137470 CCAAAACCACCTCAGGCCAGAGG 0: 1
1: 0
2: 1
3: 20
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180869299 Original CRISPR ACGAGTCCCCGATGATGACC TGG (reversed) Exonic