ID: 1180869299 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:19137404-19137426 |
Sequence | ACGAGTCCCCGATGATGACC TGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 32 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 30} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1180869299_1180869301 | 14 | Left | 1180869299 | 22:19137404-19137426 | CCAGGTCATCATCGGGGACTCGT | 0: 1 1: 0 2: 0 3: 1 4: 30 |
||
Right | 1180869301 | 22:19137441-19137463 | AAAGAGCCCAAAACCACCTCAGG | 0: 1 1: 0 2: 2 3: 10 4: 174 |
||||
1180869299_1180869304 | 21 | Left | 1180869299 | 22:19137404-19137426 | CCAGGTCATCATCGGGGACTCGT | 0: 1 1: 0 2: 0 3: 1 4: 30 |
||
Right | 1180869304 | 22:19137448-19137470 | CCAAAACCACCTCAGGCCAGAGG | 0: 1 1: 0 2: 1 3: 20 4: 200 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1180869299 | Original CRISPR | ACGAGTCCCCGATGATGACC TGG (reversed) | Exonic | ||