ID: 1180869301

View in Genome Browser
Species Human (GRCh38)
Location 22:19137441-19137463
Sequence AAAGAGCCCAAAACCACCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 174}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180869299_1180869301 14 Left 1180869299 22:19137404-19137426 CCAGGTCATCATCGGGGACTCGT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1180869301 22:19137441-19137463 AAAGAGCCCAAAACCACCTCAGG 0: 1
1: 0
2: 2
3: 10
4: 174
1180869296_1180869301 17 Left 1180869296 22:19137401-19137423 CCCCCAGGTCATCATCGGGGACT 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1180869301 22:19137441-19137463 AAAGAGCCCAAAACCACCTCAGG 0: 1
1: 0
2: 2
3: 10
4: 174
1180869298_1180869301 15 Left 1180869298 22:19137403-19137425 CCCAGGTCATCATCGGGGACTCG 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1180869301 22:19137441-19137463 AAAGAGCCCAAAACCACCTCAGG 0: 1
1: 0
2: 2
3: 10
4: 174
1180869297_1180869301 16 Left 1180869297 22:19137402-19137424 CCCCAGGTCATCATCGGGGACTC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1180869301 22:19137441-19137463 AAAGAGCCCAAAACCACCTCAGG 0: 1
1: 0
2: 2
3: 10
4: 174
1180869292_1180869301 21 Left 1180869292 22:19137397-19137419 CCTCCCCCCAGGTCATCATCGGG 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1180869301 22:19137441-19137463 AAAGAGCCCAAAACCACCTCAGG 0: 1
1: 0
2: 2
3: 10
4: 174
1180869295_1180869301 18 Left 1180869295 22:19137400-19137422 CCCCCCAGGTCATCATCGGGGAC 0: 1
1: 0
2: 0
3: 10
4: 73
Right 1180869301 22:19137441-19137463 AAAGAGCCCAAAACCACCTCAGG 0: 1
1: 0
2: 2
3: 10
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180869301 Original CRISPR AAAGAGCCCAAAACCACCTC AGG Intronic