ID: 1180869304

View in Genome Browser
Species Human (GRCh38)
Location 22:19137448-19137470
Sequence CCAAAACCACCTCAGGCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 200}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180869300_1180869304 -7 Left 1180869300 22:19137432-19137454 CCTGCAGACAAAGAGCCCAAAAC 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1180869304 22:19137448-19137470 CCAAAACCACCTCAGGCCAGAGG 0: 1
1: 0
2: 1
3: 20
4: 200
1180869295_1180869304 25 Left 1180869295 22:19137400-19137422 CCCCCCAGGTCATCATCGGGGAC 0: 1
1: 0
2: 0
3: 10
4: 73
Right 1180869304 22:19137448-19137470 CCAAAACCACCTCAGGCCAGAGG 0: 1
1: 0
2: 1
3: 20
4: 200
1180869292_1180869304 28 Left 1180869292 22:19137397-19137419 CCTCCCCCCAGGTCATCATCGGG 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1180869304 22:19137448-19137470 CCAAAACCACCTCAGGCCAGAGG 0: 1
1: 0
2: 1
3: 20
4: 200
1180869299_1180869304 21 Left 1180869299 22:19137404-19137426 CCAGGTCATCATCGGGGACTCGT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1180869304 22:19137448-19137470 CCAAAACCACCTCAGGCCAGAGG 0: 1
1: 0
2: 1
3: 20
4: 200
1180869298_1180869304 22 Left 1180869298 22:19137403-19137425 CCCAGGTCATCATCGGGGACTCG 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1180869304 22:19137448-19137470 CCAAAACCACCTCAGGCCAGAGG 0: 1
1: 0
2: 1
3: 20
4: 200
1180869297_1180869304 23 Left 1180869297 22:19137402-19137424 CCCCAGGTCATCATCGGGGACTC 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1180869304 22:19137448-19137470 CCAAAACCACCTCAGGCCAGAGG 0: 1
1: 0
2: 1
3: 20
4: 200
1180869296_1180869304 24 Left 1180869296 22:19137401-19137423 CCCCCAGGTCATCATCGGGGACT 0: 1
1: 0
2: 0
3: 8
4: 66
Right 1180869304 22:19137448-19137470 CCAAAACCACCTCAGGCCAGAGG 0: 1
1: 0
2: 1
3: 20
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180869304 Original CRISPR CCAAAACCACCTCAGGCCAG AGG Intronic