ID: 1180870578

View in Genome Browser
Species Human (GRCh38)
Location 22:19144532-19144554
Sequence GGCTGCGACGAGCAAGCAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 78}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180870578_1180870588 9 Left 1180870578 22:19144532-19144554 CCCGCTGCTTGCTCGTCGCAGCC 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1180870588 22:19144564-19144586 CCCGCCTCGCGCTTCCTCGGGGG 0: 1
1: 0
2: 0
3: 9
4: 91
1180870578_1180870592 20 Left 1180870578 22:19144532-19144554 CCCGCTGCTTGCTCGTCGCAGCC 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1180870592 22:19144575-19144597 CTTCCTCGGGGGCCTGGACGCGG 0: 1
1: 1
2: 1
3: 38
4: 184
1180870578_1180870594 23 Left 1180870578 22:19144532-19144554 CCCGCTGCTTGCTCGTCGCAGCC 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1180870594 22:19144578-19144600 CCTCGGGGGCCTGGACGCGGCGG 0: 1
1: 0
2: 0
3: 36
4: 223
1180870578_1180870591 14 Left 1180870578 22:19144532-19144554 CCCGCTGCTTGCTCGTCGCAGCC 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1180870591 22:19144569-19144591 CTCGCGCTTCCTCGGGGGCCTGG 0: 1
1: 0
2: 1
3: 9
4: 95
1180870578_1180870584 6 Left 1180870578 22:19144532-19144554 CCCGCTGCTTGCTCGTCGCAGCC 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1180870584 22:19144561-19144583 TCTCCCGCCTCGCGCTTCCTCGG 0: 1
1: 0
2: 0
3: 11
4: 132
1180870578_1180870595 24 Left 1180870578 22:19144532-19144554 CCCGCTGCTTGCTCGTCGCAGCC 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1180870595 22:19144579-19144601 CTCGGGGGCCTGGACGCGGCGGG 0: 1
1: 0
2: 0
3: 11
4: 233
1180870578_1180870585 7 Left 1180870578 22:19144532-19144554 CCCGCTGCTTGCTCGTCGCAGCC 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1180870585 22:19144562-19144584 CTCCCGCCTCGCGCTTCCTCGGG 0: 1
1: 0
2: 0
3: 13
4: 139
1180870578_1180870586 8 Left 1180870578 22:19144532-19144554 CCCGCTGCTTGCTCGTCGCAGCC 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1180870586 22:19144563-19144585 TCCCGCCTCGCGCTTCCTCGGGG 0: 1
1: 0
2: 2
3: 10
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180870578 Original CRISPR GGCTGCGACGAGCAAGCAGC GGG (reversed) Exonic
900699060 1:4032721-4032743 AGCTGCCACTAACAAGCAGCAGG - Intergenic
901024146 1:6270214-6270236 GGCTGCGAGGAGGCAGCAGCCGG - Intronic
901251103 1:7781203-7781225 AGCTGTGAGGAGAAAGCAGCTGG + Exonic
904473042 1:30747645-30747667 GGCTCTGAGGAGCAAGCAACAGG + Intronic
905172445 1:36117081-36117103 GGCAGAGGCAAGCAAGCAGCTGG - Intronic
905297352 1:36962571-36962593 GCCTGAGGCGAGCAAGCAGACGG + Intronic
906025127 1:42666937-42666959 GGCAGGAAAGAGCAAGCAGCAGG - Intronic
907221708 1:52911805-52911827 GGCAGCCACGGGAAAGCAGCTGG + Intronic
911374222 1:97030949-97030971 GGCTGGGAAGAGCAAGAAGAAGG + Intergenic
920386023 1:205570353-205570375 GACTCAGTCGAGCAAGCAGCCGG + Intronic
920415397 1:205796035-205796057 GGCTGAGAAGAGCAGGGAGCAGG - Intronic
924415366 1:243850922-243850944 GGATGCGCCGAGGAAGCGGCTGG - Intronic
1066243732 10:33562108-33562130 AGCTGCCAGGAGCAGGCAGCGGG + Intergenic
1067091837 10:43270765-43270787 GGCTGCGAGGAACAAGTAGTAGG + Intergenic
1076221158 10:128734175-128734197 GGCTGAAACTAGCAACCAGCTGG - Intergenic
1076307786 10:129476948-129476970 GGCTGCGAGGACCATGCGGCTGG - Intronic
1077081675 11:727194-727216 GGCTGGCACCACCAAGCAGCAGG - Exonic
1083680516 11:64349593-64349615 GGCGGCGACCAGCAAGGAGGAGG + Exonic
1083868465 11:65471701-65471723 GGCAGCCACCAGCAATCAGCAGG - Intergenic
1084216051 11:67647461-67647483 AGCTGGGAGGAGCAAGCAGGAGG - Intronic
1091994823 12:4985183-4985205 GTCTGCGAGGAGAGAGCAGCCGG + Intergenic
1093459427 12:19394913-19394935 GGCTGCGGTGAGCAAGCATTGGG + Intergenic
1096523912 12:52199480-52199502 GGCTGCAACCAGCCGGCAGCTGG - Intergenic
1100741391 12:97597235-97597257 AGCTGTGAGGGGCAAGCAGCTGG - Intergenic
1105037103 12:132933523-132933545 GGCTGCAGCGAGGAAGGAGCTGG - Intronic
1108085647 13:46789116-46789138 GGCAGCAACTAGAAAGCAGCAGG - Intronic
1115399193 14:32938961-32938983 GGCGGCGCCGGGCGAGCAGCGGG + Intronic
1119842290 14:77802305-77802327 AGATGCAAAGAGCAAGCAGCAGG - Intronic
1120815000 14:88846960-88846982 GGGTGGGACGAGCAAGGAGGAGG - Intronic
1121190643 14:92026466-92026488 GGCTGCGGCGAGCAAGGAGGCGG - Intronic
1121340003 14:93099563-93099585 GGCTGCGCCCAGCAGCCAGCTGG - Intronic
1122288203 14:100665343-100665365 GACTGAGACGAGCAAGAAACAGG + Intergenic
1123793978 15:23753330-23753352 GGCTGGGACAAGCAAGCCACAGG - Intergenic
1129273970 15:74433520-74433542 CGCTGCGGCGAGCGAGCGGCGGG - Intronic
1129716821 15:77857196-77857218 GGCAGGGACGAGGAGGCAGCTGG - Intergenic
1132715115 16:1286263-1286285 GGCTGAGACGGGGGAGCAGCAGG + Intergenic
1142467833 17:146226-146248 AGATGCCACGAGCAAGCACCCGG + Intergenic
1142899413 17:3003019-3003041 GCCTGGCATGAGCAAGCAGCTGG - Intronic
1152819576 17:82429924-82429946 GGAAGCGACCAGCAGGCAGCTGG - Intronic
1153716892 18:7859379-7859401 GGCTGCCACCAGCAAGGATCAGG - Intronic
1164809618 19:31145972-31145994 GGCTGCAACGAGCCAGCATTAGG + Intergenic
927171575 2:20374975-20374997 GGCAGCGAGGAGCAAGCGACGGG + Intergenic
929998518 2:46845495-46845517 GGATGTCAGGAGCAAGCAGCTGG - Intronic
930242086 2:48946379-48946401 GGCTGCTAAGAGCAATCAGCTGG + Intergenic
930649880 2:53953970-53953992 GGCTGTGAGGAGGAAGCGGCTGG - Intronic
932577582 2:72971302-72971324 GGGTGAGACAAGCAAGAAGCTGG + Intronic
937004407 2:118498008-118498030 GGGTGCCAAGATCAAGCAGCTGG + Intergenic
941819966 2:169834640-169834662 GGCTGGGACGAAAAAGCAGTGGG - Intronic
947641154 2:231708570-231708592 GGCTGCGGCGAGCAAGGAGGCGG - Exonic
1169278872 20:4250496-4250518 GCCTGCCACGTGCCAGCAGCCGG - Intergenic
1170623323 20:18011835-18011857 GGCTGCGGCGAGCAAGGAGCCGG - Intronic
1172913707 20:38428718-38428740 AGCAGCGTCCAGCAAGCAGCTGG + Intergenic
1180870578 22:19144532-19144554 GGCTGCGACGAGCAAGCAGCGGG - Exonic
1181014514 22:20061509-20061531 GCCTGTGAGGAGCAATCAGCGGG - Exonic
950425801 3:12924195-12924217 GGCTGGCAGGAGCAGGCAGCTGG - Intronic
961243990 3:125435692-125435714 GGCTGCGGCCAACAAGCAGTTGG - Intergenic
964389601 3:156183606-156183628 GGCTGCTATGGGCAAACAGCAGG - Intronic
967992600 3:195142685-195142707 GGCACCGCCGAGCAGGCAGCCGG + Intronic
968353432 3:198081081-198081103 GGCTGCTGCGAGCAGGCAGAGGG + Intergenic
969921855 4:10547651-10547673 GGCTGCCAGGAGCAAGGAGGAGG - Intronic
972703302 4:41515212-41515234 GGCTGCGGTGATCACGCAGCCGG + Intronic
979547261 4:121951922-121951944 GGCTGCGACGAGGAAGCCCGGGG + Intergenic
980847416 4:138340904-138340926 GGCTGCGACCAGGTAGCAGCAGG + Intergenic
988585192 5:32501764-32501786 GGCTGCGAAAAGCAGGGAGCAGG + Intergenic
996055052 5:118973605-118973627 GGCTGCCGCGAGCAAGGAGGCGG - Intronic
998463604 5:142326102-142326124 GGCTGCGCCGAGGATGCTGCCGG + Intronic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1007180119 6:39923577-39923599 GGCTGGGCCTGGCAAGCAGCTGG + Intronic
1019112042 6:169724351-169724373 GGCTGAGGCGAGCGAGCGGCGGG - Intronic
1019302131 7:311019-311041 GGCTGCCACGATCAGGCAGAAGG + Intergenic
1024131221 7:46354724-46354746 GGCTGCGAAAAGCAAGAGGCAGG + Intergenic
1026045673 7:66904076-66904098 CGCAGCCACGAGCAAGGAGCTGG - Intergenic
1030616033 7:111739032-111739054 AGCTGCCAAAAGCAAGCAGCTGG - Intronic
1034879468 7:154752373-154752395 GGCTGTGACTGGCAAGGAGCGGG + Intronic
1037260361 8:17001531-17001553 GGCTGCGGCGACAAACCAGCAGG + Intronic
1039068782 8:33632008-33632030 GGCGGCGTGGAGCAAGGAGCGGG - Intergenic
1042040287 8:64581805-64581827 GGCGCCTACGAGCAGGCAGCCGG + Exonic
1047220420 8:122914222-122914244 GGCTGCCAGGATCAGGCAGCAGG - Intronic
1049458233 8:142705827-142705849 GGCTGCGAATTGGAAGCAGCTGG - Intergenic
1056013983 9:82362688-82362710 GGCTGCCAAGAGTCAGCAGCAGG + Intergenic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1199643988 X:149887428-149887450 AGCAGGGAAGAGCAAGCAGCGGG - Intergenic
1199853114 X:151739271-151739293 TGGTGCGAAGAGCAAGCAGGAGG - Intronic
1200093127 X:153644935-153644957 GGCTGTGACCAGCAGGGAGCTGG - Intronic