ID: 1180874382

View in Genome Browser
Species Human (GRCh38)
Location 22:19168378-19168400
Sequence AGGTGAGTAGGTGGGGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180874382_1180874391 12 Left 1180874382 22:19168378-19168400 CCCGCGGCCCCACCTACTCACCT No data
Right 1180874391 22:19168413-19168435 ACCTCGACTCCTGTGCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180874382 Original CRISPR AGGTGAGTAGGTGGGGCCGC GGG (reversed) Intergenic
No off target data available for this crispr