ID: 1180874835

View in Genome Browser
Species Human (GRCh38)
Location 22:19170309-19170331
Sequence CAGGGACCCCAAAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180874835_1180874848 26 Left 1180874835 22:19170309-19170331 CCATCTTCCCTTTGGGGTCCCTG No data
Right 1180874848 22:19170358-19170380 TGTTGACCAACTCACTGACAGGG No data
1180874835_1180874847 25 Left 1180874835 22:19170309-19170331 CCATCTTCCCTTTGGGGTCCCTG No data
Right 1180874847 22:19170357-19170379 CTGTTGACCAACTCACTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180874835 Original CRISPR CAGGGACCCCAAAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr