ID: 1180874890

View in Genome Browser
Species Human (GRCh38)
Location 22:19170614-19170636
Sequence CAGGAACAGGAGAAGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180874890_1180874904 11 Left 1180874890 22:19170614-19170636 CCTGACTCCTTCTCCTGTTCCTG No data
Right 1180874904 22:19170648-19170670 CCAGAGTAGGTGGCTCAGAGGGG No data
1180874890_1180874900 9 Left 1180874890 22:19170614-19170636 CCTGACTCCTTCTCCTGTTCCTG No data
Right 1180874900 22:19170646-19170668 CCCCAGAGTAGGTGGCTCAGAGG No data
1180874890_1180874897 1 Left 1180874890 22:19170614-19170636 CCTGACTCCTTCTCCTGTTCCTG No data
Right 1180874897 22:19170638-19170660 CAGCAGGCCCCCAGAGTAGGTGG No data
1180874890_1180874902 10 Left 1180874890 22:19170614-19170636 CCTGACTCCTTCTCCTGTTCCTG No data
Right 1180874902 22:19170647-19170669 CCCAGAGTAGGTGGCTCAGAGGG No data
1180874890_1180874895 -2 Left 1180874890 22:19170614-19170636 CCTGACTCCTTCTCCTGTTCCTG No data
Right 1180874895 22:19170635-19170657 TGCCAGCAGGCCCCCAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180874890 Original CRISPR CAGGAACAGGAGAAGGAGTC AGG (reversed) Intergenic
No off target data available for this crispr