ID: 1180875210

View in Genome Browser
Species Human (GRCh38)
Location 22:19171919-19171941
Sequence GAGAGGCGCTGTGCCCGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180875210_1180875218 1 Left 1180875210 22:19171919-19171941 CCCTGGCGGGCACAGCGCCTCTC No data
Right 1180875218 22:19171943-19171965 CGTGACCTGGGCCGGCCCGCAGG No data
1180875210_1180875214 -7 Left 1180875210 22:19171919-19171941 CCCTGGCGGGCACAGCGCCTCTC No data
Right 1180875214 22:19171935-19171957 GCCTCTCCCGTGACCTGGGCCGG No data
1180875210_1180875221 13 Left 1180875210 22:19171919-19171941 CCCTGGCGGGCACAGCGCCTCTC No data
Right 1180875221 22:19171955-19171977 CGGCCCGCAGGATGAGCCCCCGG No data
1180875210_1180875224 27 Left 1180875210 22:19171919-19171941 CCCTGGCGGGCACAGCGCCTCTC No data
Right 1180875224 22:19171969-19171991 AGCCCCCGGATCACGATCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180875210 Original CRISPR GAGAGGCGCTGTGCCCGCCA GGG (reversed) Intergenic
No off target data available for this crispr