ID: 1180876707

View in Genome Browser
Species Human (GRCh38)
Location 22:19178273-19178295
Sequence CCCGAGCGCCAGCGGCCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180876707_1180876722 10 Left 1180876707 22:19178273-19178295 CCGCCCGGCCGCTGGCGCTCGGG 0: 1
1: 1
2: 3
3: 16
4: 154
Right 1180876722 22:19178306-19178328 GTCCCGGACTTCGGTCGGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 10
1180876707_1180876715 1 Left 1180876707 22:19178273-19178295 CCGCCCGGCCGCTGGCGCTCGGG 0: 1
1: 1
2: 3
3: 16
4: 154
Right 1180876715 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 15
4: 185
1180876707_1180876712 -6 Left 1180876707 22:19178273-19178295 CCGCCCGGCCGCTGGCGCTCGGG 0: 1
1: 1
2: 3
3: 16
4: 154
Right 1180876712 22:19178290-19178312 CTCGGGCCCCTCCCCCGTCCCGG 0: 1
1: 0
2: 4
3: 33
4: 367
1180876707_1180876725 30 Left 1180876707 22:19178273-19178295 CCGCCCGGCCGCTGGCGCTCGGG 0: 1
1: 1
2: 3
3: 16
4: 154
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139
1180876707_1180876718 5 Left 1180876707 22:19178273-19178295 CCGCCCGGCCGCTGGCGCTCGGG 0: 1
1: 1
2: 3
3: 16
4: 154
Right 1180876718 22:19178301-19178323 CCCCCGTCCCGGACTTCGGTCGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180876707 Original CRISPR CCCGAGCGCCAGCGGCCGGG CGG (reversed) Intronic