ID: 1180876709

View in Genome Browser
Species Human (GRCh38)
Location 22:19178276-19178298
Sequence GGGCCCGAGCGCCAGCGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 209}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180876709_1180876722 7 Left 1180876709 22:19178276-19178298 CCCGGCCGCTGGCGCTCGGGCCC 0: 1
1: 0
2: 3
3: 21
4: 209
Right 1180876722 22:19178306-19178328 GTCCCGGACTTCGGTCGGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 10
1180876709_1180876712 -9 Left 1180876709 22:19178276-19178298 CCCGGCCGCTGGCGCTCGGGCCC 0: 1
1: 0
2: 3
3: 21
4: 209
Right 1180876712 22:19178290-19178312 CTCGGGCCCCTCCCCCGTCCCGG 0: 1
1: 0
2: 4
3: 33
4: 367
1180876709_1180876725 27 Left 1180876709 22:19178276-19178298 CCCGGCCGCTGGCGCTCGGGCCC 0: 1
1: 0
2: 3
3: 21
4: 209
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139
1180876709_1180876718 2 Left 1180876709 22:19178276-19178298 CCCGGCCGCTGGCGCTCGGGCCC 0: 1
1: 0
2: 3
3: 21
4: 209
Right 1180876718 22:19178301-19178323 CCCCCGTCCCGGACTTCGGTCGG 0: 1
1: 0
2: 0
3: 1
4: 33
1180876709_1180876727 29 Left 1180876709 22:19178276-19178298 CCCGGCCGCTGGCGCTCGGGCCC 0: 1
1: 0
2: 3
3: 21
4: 209
Right 1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
1180876709_1180876715 -2 Left 1180876709 22:19178276-19178298 CCCGGCCGCTGGCGCTCGGGCCC 0: 1
1: 0
2: 3
3: 21
4: 209
Right 1180876715 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 15
4: 185
1180876709_1180876726 28 Left 1180876709 22:19178276-19178298 CCCGGCCGCTGGCGCTCGGGCCC 0: 1
1: 0
2: 3
3: 21
4: 209
Right 1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180876709 Original CRISPR GGGCCCGAGCGCCAGCGGCC GGG (reversed) Intronic