ID: 1180876710

View in Genome Browser
Species Human (GRCh38)
Location 22:19178277-19178299
Sequence GGGGCCCGAGCGCCAGCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 278}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180876710_1180876712 -10 Left 1180876710 22:19178277-19178299 CCGGCCGCTGGCGCTCGGGCCCC 0: 1
1: 0
2: 2
3: 35
4: 278
Right 1180876712 22:19178290-19178312 CTCGGGCCCCTCCCCCGTCCCGG 0: 1
1: 0
2: 4
3: 33
4: 367
1180876710_1180876718 1 Left 1180876710 22:19178277-19178299 CCGGCCGCTGGCGCTCGGGCCCC 0: 1
1: 0
2: 2
3: 35
4: 278
Right 1180876718 22:19178301-19178323 CCCCCGTCCCGGACTTCGGTCGG 0: 1
1: 0
2: 0
3: 1
4: 33
1180876710_1180876727 28 Left 1180876710 22:19178277-19178299 CCGGCCGCTGGCGCTCGGGCCCC 0: 1
1: 0
2: 2
3: 35
4: 278
Right 1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
1180876710_1180876726 27 Left 1180876710 22:19178277-19178299 CCGGCCGCTGGCGCTCGGGCCCC 0: 1
1: 0
2: 2
3: 35
4: 278
Right 1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 145
1180876710_1180876722 6 Left 1180876710 22:19178277-19178299 CCGGCCGCTGGCGCTCGGGCCCC 0: 1
1: 0
2: 2
3: 35
4: 278
Right 1180876722 22:19178306-19178328 GTCCCGGACTTCGGTCGGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 10
1180876710_1180876725 26 Left 1180876710 22:19178277-19178299 CCGGCCGCTGGCGCTCGGGCCCC 0: 1
1: 0
2: 2
3: 35
4: 278
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139
1180876710_1180876715 -3 Left 1180876710 22:19178277-19178299 CCGGCCGCTGGCGCTCGGGCCCC 0: 1
1: 0
2: 2
3: 35
4: 278
Right 1180876715 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 15
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180876710 Original CRISPR GGGGCCCGAGCGCCAGCGGC CGG (reversed) Intronic