ID: 1180876711

View in Genome Browser
Species Human (GRCh38)
Location 22:19178281-19178303
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 311}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180876711_1180876722 2 Left 1180876711 22:19178281-19178303 CCGCTGGCGCTCGGGCCCCTCCC 0: 1
1: 0
2: 2
3: 30
4: 311
Right 1180876722 22:19178306-19178328 GTCCCGGACTTCGGTCGGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 10
1180876711_1180876727 24 Left 1180876711 22:19178281-19178303 CCGCTGGCGCTCGGGCCCCTCCC 0: 1
1: 0
2: 2
3: 30
4: 311
Right 1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
1180876711_1180876715 -7 Left 1180876711 22:19178281-19178303 CCGCTGGCGCTCGGGCCCCTCCC 0: 1
1: 0
2: 2
3: 30
4: 311
Right 1180876715 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 15
4: 185
1180876711_1180876725 22 Left 1180876711 22:19178281-19178303 CCGCTGGCGCTCGGGCCCCTCCC 0: 1
1: 0
2: 2
3: 30
4: 311
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139
1180876711_1180876726 23 Left 1180876711 22:19178281-19178303 CCGCTGGCGCTCGGGCCCCTCCC 0: 1
1: 0
2: 2
3: 30
4: 311
Right 1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 145
1180876711_1180876718 -3 Left 1180876711 22:19178281-19178303 CCGCTGGCGCTCGGGCCCCTCCC 0: 1
1: 0
2: 2
3: 30
4: 311
Right 1180876718 22:19178301-19178323 CCCCCGTCCCGGACTTCGGTCGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180876711 Original CRISPR GGGAGGGGCCCGAGCGCCAG CGG (reversed) Intronic