ID: 1180876714

View in Genome Browser
Species Human (GRCh38)
Location 22:19178297-19178319
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180876714_1180876726 7 Left 1180876714 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 145
1180876714_1180876733 21 Left 1180876714 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1180876733 22:19178341-19178363 TGCCGCGGGGAACATAGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1180876714_1180876727 8 Left 1180876714 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
1180876714_1180876732 20 Left 1180876714 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1180876732 22:19178340-19178362 GTGCCGCGGGGAACATAGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 55
1180876714_1180876734 22 Left 1180876714 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1180876734 22:19178342-19178364 GCCGCGGGGAACATAGGCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 75
1180876714_1180876725 6 Left 1180876714 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139
1180876714_1180876730 16 Left 1180876714 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180876714 Original CRISPR CCGAAGTCCGGGACGGGGGA GGG (reversed) Intronic