ID: 1180876720

View in Genome Browser
Species Human (GRCh38)
Location 22:19178303-19178325
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 16}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180876720_1180876732 14 Left 1180876720 22:19178303-19178325 CCCGTCCCGGACTTCGGTCGGCG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1180876732 22:19178340-19178362 GTGCCGCGGGGAACATAGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 55
1180876720_1180876726 1 Left 1180876720 22:19178303-19178325 CCCGTCCCGGACTTCGGTCGGCG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 145
1180876720_1180876733 15 Left 1180876720 22:19178303-19178325 CCCGTCCCGGACTTCGGTCGGCG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1180876733 22:19178341-19178363 TGCCGCGGGGAACATAGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1180876720_1180876730 10 Left 1180876720 22:19178303-19178325 CCCGTCCCGGACTTCGGTCGGCG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73
1180876720_1180876727 2 Left 1180876720 22:19178303-19178325 CCCGTCCCGGACTTCGGTCGGCG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
1180876720_1180876734 16 Left 1180876720 22:19178303-19178325 CCCGTCCCGGACTTCGGTCGGCG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1180876734 22:19178342-19178364 GCCGCGGGGAACATAGGCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 75
1180876720_1180876725 0 Left 1180876720 22:19178303-19178325 CCCGTCCCGGACTTCGGTCGGCG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180876720 Original CRISPR CGCCGACCGAAGTCCGGGAC GGG (reversed) Intronic