ID: 1180876723

View in Genome Browser
Species Human (GRCh38)
Location 22:19178308-19178330
Sequence GGCCGCGCCGACCGAAGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 35}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180876723_1180876726 -4 Left 1180876723 22:19178308-19178330 CCCGGACTTCGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 145
1180876723_1180876732 9 Left 1180876723 22:19178308-19178330 CCCGGACTTCGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1180876732 22:19178340-19178362 GTGCCGCGGGGAACATAGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 55
1180876723_1180876725 -5 Left 1180876723 22:19178308-19178330 CCCGGACTTCGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139
1180876723_1180876733 10 Left 1180876723 22:19178308-19178330 CCCGGACTTCGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1180876733 22:19178341-19178363 TGCCGCGGGGAACATAGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1180876723_1180876734 11 Left 1180876723 22:19178308-19178330 CCCGGACTTCGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1180876734 22:19178342-19178364 GCCGCGGGGAACATAGGCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 75
1180876723_1180876727 -3 Left 1180876723 22:19178308-19178330 CCCGGACTTCGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
1180876723_1180876730 5 Left 1180876723 22:19178308-19178330 CCCGGACTTCGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180876723 Original CRISPR GGCCGCGCCGACCGAAGTCC GGG (reversed) Intronic
900414870 1:2530314-2530336 GGCCGCGGCGCCCGGACTCCAGG - Intergenic
902783092 1:18716942-18716964 GGCCGGGCGGACCCAAGTCCAGG + Intronic
903413774 1:23168103-23168125 GGCCGCGCCGGCCCGCGTCCCGG - Intronic
910647035 1:89525060-89525082 AGCCGCGCCGACCGAGGTGGTGG + Intronic
914824949 1:151133367-151133389 CGCCGCGCCCACCGACGTCGGGG - Exonic
921945010 1:220880151-220880173 GGTGGCGCCCTCCGAAGTCCCGG + Exonic
922821285 1:228487470-228487492 GGCCCCGCCGCCCGCAGCCCTGG + Exonic
924775503 1:247112446-247112468 GGCCCCGCCGGCCTGAGTCCTGG + Intergenic
1073812397 10:107164825-107164847 GGACGCGGCGCCCGGAGTCCCGG - Intergenic
1077024524 11:433324-433346 GGCCGCGCCGACCACCATCCCGG - Exonic
1078053470 11:7987388-7987410 GGCCACGCCAACCCCAGTCCCGG + Exonic
1089281178 11:117375704-117375726 GGCTGCGAAAACCGAAGTCCTGG - Exonic
1101409558 12:104457322-104457344 CGCCGCGCGGACCGGAGCCCGGG - Exonic
1102026036 12:109714704-109714726 GCCTGCGCCGTCCGAAGTCGGGG - Exonic
1121515688 14:94548451-94548473 TGCAGTGCTGACCGAAGTCCAGG - Intergenic
1141657747 16:85425078-85425100 GGGAGGGCCGACCGGAGTCCTGG - Intergenic
1141841455 16:86576730-86576752 GGCCGCGCCCGCCTAGGTCCTGG - Intronic
1144547994 17:16215440-16215462 CGCCGCGCCGAACGAGGTCCCGG - Exonic
1147452126 17:40512264-40512286 GGCGGCGGCGACTGAAGTCTTGG - Intergenic
1152295435 17:79464473-79464495 GGCCGCCCCGACAGATGTACTGG - Intronic
1152349884 17:79778496-79778518 GGCCGCGCCGTCCGGTGGCCTGG + Intronic
1160863913 19:1249039-1249061 GGGAGCGCCGCCCGGAGTCCCGG - Intronic
1161483751 19:4523875-4523897 GGCCGCGCTGGCCGAGGGCCGGG - Exonic
1162100196 19:8334572-8334594 GGCCGCGCAGACCGAGTCCCCGG - Exonic
1164952088 19:32345529-32345551 GGCCCCGCCTACCGGCGTCCCGG - Intergenic
929646915 2:43637332-43637354 GGCCGCAGCGCCCGATGTCCCGG - Exonic
942098585 2:172556336-172556358 GGCCGCACTCACCGAAGTCCAGG - Exonic
946003071 2:216499084-216499106 GGCCGCGCGCTCCGAAGGCCCGG - Intronic
948598064 2:239093076-239093098 GGCCTCGCCCAGCGGAGTCCTGG - Intronic
1176215207 20:63944650-63944672 GGCCGCGCTCACTGATGTCCCGG + Exonic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1182451710 22:30425796-30425818 GGCCGGGCAGACCCAAGTGCCGG + Exonic
973533888 4:51861386-51861408 GGCCCAGCTCACCGAAGTCCTGG + Intronic
979468725 4:121071379-121071401 GGTCGGGCCAACCGAACTCCCGG + Intronic
983904451 4:173169253-173169275 GCCCGCTCCGCCCGCAGTCCCGG - Intronic
1007626134 6:43247320-43247342 GGCCGAGCAGCCCGAAGCCCCGG - Intronic
1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG + Intronic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1033756929 7:144403696-144403718 GGCCGCGGCGGCGGGAGTCCAGG - Intronic
1203771974 EBV:54100-54122 GGCCGAGGCGGCCGAGGTCCGGG - Intergenic
1197335223 X:125203894-125203916 GGCCGAGACGCCCTAAGTCCCGG - Intergenic
1198651075 X:138864498-138864520 GGCCCAGCCAACCGAAGTCCTGG + Intronic