ID: 1180876725

View in Genome Browser
Species Human (GRCh38)
Location 22:19178326-19178348
Sequence CGGCCGCCGCGCCAGTGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 139}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180876723_1180876725 -5 Left 1180876723 22:19178308-19178330 CCCGGACTTCGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139
1180876714_1180876725 6 Left 1180876714 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139
1180876713_1180876725 7 Left 1180876713 22:19178296-19178318 CCCCTCCCCCGTCCCGGACTTCG 0: 1
1: 0
2: 0
3: 21
4: 204
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139
1180876711_1180876725 22 Left 1180876711 22:19178281-19178303 CCGCTGGCGCTCGGGCCCCTCCC 0: 1
1: 0
2: 2
3: 30
4: 311
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139
1180876720_1180876725 0 Left 1180876720 22:19178303-19178325 CCCGTCCCGGACTTCGGTCGGCG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139
1180876721_1180876725 -1 Left 1180876721 22:19178304-19178326 CCGTCCCGGACTTCGGTCGGCGC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139
1180876709_1180876725 27 Left 1180876709 22:19178276-19178298 CCCGGCCGCTGGCGCTCGGGCCC 0: 1
1: 0
2: 3
3: 21
4: 209
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139
1180876717_1180876725 2 Left 1180876717 22:19178301-19178323 CCCCCGTCCCGGACTTCGGTCGG 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139
1180876710_1180876725 26 Left 1180876710 22:19178277-19178299 CCGGCCGCTGGCGCTCGGGCCCC 0: 1
1: 0
2: 2
3: 35
4: 278
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139
1180876707_1180876725 30 Left 1180876707 22:19178273-19178295 CCGCCCGGCCGCTGGCGCTCGGG 0: 1
1: 1
2: 3
3: 16
4: 154
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139
1180876719_1180876725 1 Left 1180876719 22:19178302-19178324 CCCCGTCCCGGACTTCGGTCGGC 0: 1
1: 0
2: 0
3: 4
4: 26
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139
1180876724_1180876725 -6 Left 1180876724 22:19178309-19178331 CCGGACTTCGGTCGGCGCGGCCG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139
1180876716_1180876725 5 Left 1180876716 22:19178298-19178320 CCTCCCCCGTCCCGGACTTCGGT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG 0: 1
1: 0
2: 1
3: 6
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180876725 Original CRISPR CGGCCGCCGCGCCAGTGCCG CGG Intronic
900651465 1:3732147-3732169 CTGCCCCCCAGCCAGTGCCGCGG + Intronic
901148754 1:7086286-7086308 CGGCGGCCTCCCCAGTGCCCTGG - Intronic
902169497 1:14598784-14598806 CCGCCGCCTCGCCACCGCCGCGG + Exonic
902350224 1:15848379-15848401 CGGCGGCCGCGTCCGTGACGAGG + Intronic
902823176 1:18955939-18955961 CGGCCGCCGCGCCACTGCTGAGG + Exonic
903132728 1:21290226-21290248 CGGCGGCGGCGCCAGGGTCGGGG - Intronic
903948566 1:26980151-26980173 CAGCCGCCTCCCCAGTGCCATGG + Intergenic
904037926 1:27568698-27568720 CGGCCGCGGCGCGGGTGCCCGGG + Intronic
904641954 1:31937944-31937966 CGGCCCCCGCGCCGGCGCCGGGG - Intronic
905647232 1:39633136-39633158 CGGCCGGCGCGCCCGGCCCGTGG - Intronic
908473999 1:64470776-64470798 CGGCCGCCGCGCCCGGGCCACGG - Exonic
914937452 1:151993542-151993564 GGGCGGCCGCGCCCGGGCCGGGG + Intronic
917846730 1:179026133-179026155 CGCCCGCCGCGCCGGGGGCGGGG - Intronic
922505228 1:226122151-226122173 CCGCGGCCACGCCAGCGCCGGGG - Intergenic
924775258 1:247111636-247111658 CGCCCTCCCCGCCGGTGCCGGGG + Exonic
1063443023 10:6088961-6088983 CGGCCTCTGCGCCTGCGCCGAGG - Intergenic
1073122655 10:101131892-101131914 CGGCAGCAGCGGCGGTGCCGGGG + Exonic
1075370037 10:121927984-121928006 CGGCGGCCGCGCTAGCGACGCGG - Exonic
1076793229 10:132787397-132787419 CGGCGGCCGCACCACTGCCCCGG - Intergenic
1079459772 11:20669505-20669527 CCGCCGCCGCGCCAGCGGTGGGG + Intergenic
1080418650 11:32091646-32091668 CCGCCGCCGCGCCCCGGCCGGGG + Intronic
1083571471 11:63764092-63764114 CGGAGGCTGCGGCAGTGCCGGGG + Exonic
1083965786 11:66042942-66042964 CGCCGCCCGCGCCAGCGCCGCGG + Exonic
1084000152 11:66291782-66291804 CGGCGGCGCCGCCGGTGCCGCGG + Intergenic
1084179329 11:67438670-67438692 CGGCAGCCTGGCCAGAGCCGGGG - Exonic
1084363737 11:68684810-68684832 CGGCGGCCGGGCCAGGGCCCTGG - Intronic
1085504089 11:77046178-77046200 GGAGCGCCGGGCCAGTGCCGTGG - Intergenic
1086349857 11:85934762-85934784 CGGCCGCCGCGCCAGCGTCTGGG + Intergenic
1089993382 11:122882770-122882792 CAGCCTCCGTGCCAGGGCCGGGG + Exonic
1090003990 11:122984317-122984339 CAGCCGCCCCGCCTCTGCCGGGG + Intergenic
1090710077 11:129375952-129375974 CCGCCGTCGCGCCAGCCCCGCGG + Exonic
1091381904 12:67213-67235 CGGCCGCCGCGTCAGCACCACGG + Exonic
1091857385 12:3750861-3750883 CGGCCACTGCCCCAGTGCTGGGG + Intronic
1092861489 12:12723917-12723939 CGCCCGCCGCGGCAGTTGCGGGG + Intergenic
1096673051 12:53211471-53211493 CGGCTCCCTCGCCAGTCCCGGGG - Exonic
1098991023 12:77065313-77065335 CGGCCCCAGCGCCAGTGGGGAGG - Intronic
1100830938 12:98516095-98516117 CGGCGGCGGCCCCAGAGCCGAGG - Exonic
1101592720 12:106138624-106138646 GGGCCGCCGCGCCTGTGGCGGGG - Exonic
1102371015 12:112382318-112382340 CGGCGGCGGCGGCAGGGCCGGGG - Intronic
1103474810 12:121210434-121210456 CAGCCGCCGCGCCGGGGCCCCGG + Intronic
1103764720 12:123271857-123271879 CGGCCGCCCCGCCGGCTCCGCGG - Exonic
1105240849 13:18609064-18609086 CCGCCGCCGCCCCAGTGTCCGGG + Intergenic
1105492609 13:20902932-20902954 CGGCCGCCGCGCTGGGGCGGGGG + Intronic
1106517094 13:30465201-30465223 CCGCCGCCGCGACCGGGCCGAGG + Intronic
1112507845 13:99985553-99985575 CGGCGGCAGCGGCAGTGGCGGGG + Exonic
1115768479 14:36647321-36647343 CTCCCGCCGCGCCAGCACCGTGG + Intergenic
1117424548 14:55580611-55580633 CGGGTGCCGCGACAGAGCCGGGG - Intronic
1117978927 14:61322605-61322627 CGGTCGCGTCACCAGTGCCGCGG - Intronic
1118220958 14:63853733-63853755 CCGCCGCCCCTCCAGTGCCCGGG - Intronic
1119379149 14:74217801-74217823 CGGTGGCCGCGCGAGTGGCGCGG - Intergenic
1122217646 14:100214526-100214548 CTGCCGCCCCGCCTGTGTCGCGG - Intergenic
1123180072 14:106461056-106461078 TGGCCGCCGGAGCAGTGCCGGGG - Intergenic
1127449813 15:59105428-59105450 CGGCCGCAGGGCCAGGGACGCGG - Intronic
1129298938 15:74614753-74614775 CGGCCGCCGGGGCGGTGCTGGGG + Intronic
1132650495 16:1019396-1019418 CGGCCGCCGCTCCCGTGGGGTGG - Intergenic
1133259469 16:4538707-4538729 CGGCCGCTGCCCCAGGGCTGCGG - Intronic
1133784471 16:8963687-8963709 CGTCCGCCGCGCCCGGCCCGAGG - Intronic
1137617628 16:49856713-49856735 CGGCAGGCGCGCCCGTGCCCCGG + Intronic
1139516683 16:67456576-67456598 CAGCTGCCGCACCAGTGCCTGGG - Intronic
1141538477 16:84699973-84699995 CGGCCGCCGCGCCTGCGCACTGG - Intronic
1141608761 16:85169902-85169924 CGGCCGCCGTGGCGGCGCCGGGG + Intergenic
1141863346 16:86733144-86733166 GGGCCTCCGCGTCAGTGCCTGGG + Intergenic
1142980556 17:3668748-3668770 CGCCCTCCGCGCCTGCGCCGTGG - Intronic
1144816619 17:18039644-18039666 CCGCCGCCGCGCGGGAGCCGAGG - Exonic
1144849441 17:18236639-18236661 CGGCCGCAGCGCCACACCCGAGG - Exonic
1148807899 17:50273400-50273422 CGGAGGCCGCCCCAGTGCGGAGG - Intronic
1149894825 17:60421656-60421678 CTGCTGCCGCGCCAGGGGCGAGG + Intronic
1151351869 17:73536629-73536651 CTGCCCCCACGCCAGTGCGGGGG + Intronic
1151969374 17:77450052-77450074 CGGGCGCCAGGCCAGAGCCGGGG - Intronic
1152696027 17:81796050-81796072 CCCCAGCCGCCCCAGTGCCGGGG + Intergenic
1155199352 18:23503594-23503616 CGGGCGCCGCGCCCGCGGCGGGG - Exonic
1156448635 18:37254173-37254195 CGGGCGCCGGGCGAGTGACGCGG - Intronic
1158893525 18:61894041-61894063 CGGCGGCCGCGCCGAAGCCGTGG - Intronic
1160558160 18:79739544-79739566 TGGAAGCCGCGCCAGAGCCGAGG - Intronic
1160907213 19:1456999-1457021 CGGCCGCGGCCTCGGTGCCGTGG - Exonic
1160967920 19:1754595-1754617 CGGCCGCTGCGCCCGCGCTGGGG - Exonic
1160987999 19:1848408-1848430 CGACCGCGGCGCCAGTGAGGGGG - Exonic
1161236648 19:3201617-3201639 CGCACGCCGCGTGAGTGCCGGGG + Exonic
1162426942 19:10602641-10602663 CAGCCGCAGCGCCGGTGCCTAGG - Intronic
1162921621 19:13906471-13906493 CGGCCGCGGCGCCTCTGCCCGGG - Exonic
1163513076 19:17747711-17747733 CGGCAGCCGCGCCGCAGCCGCGG + Exonic
1165080610 19:33303849-33303871 AGGCCTCAGCGCCAGTGGCGAGG - Intergenic
1165236810 19:34428431-34428453 CAGCCCCCGCGACAGTGCCATGG - Exonic
1166074188 19:40404271-40404293 CGGCTGCCGCTCCAGGGCCTCGG - Intronic
1166351309 19:42199732-42199754 CAGCTGCCGCGCCAGCGCCTGGG + Exonic
1167721157 19:51181559-51181581 CGGCCGTCGCCCCAGTGAGGCGG - Intergenic
931291933 2:60881361-60881383 CAGCCGCCGCAGCAGCGCCGGGG + Intergenic
934261197 2:91478113-91478135 CCGCCGCCGCCCCGGTGCCGCGG + Intergenic
934754440 2:96815969-96815991 CGGGCGCCGCGCACGGGCCGAGG + Intergenic
934882483 2:97995895-97995917 CGCCCGCCGCGCCTGACCCGCGG - Intergenic
935137712 2:100322047-100322069 CCGCCGCCGCCCCAGTGTCCTGG - Exonic
935265180 2:101387488-101387510 CGCCAGCAGCGCTAGTGCCGGGG + Exonic
941934485 2:170972407-170972429 CGGCCGCTGCTGCAGGGCCGGGG + Intergenic
945948070 2:216013401-216013423 CGGCCACCGCGCCAGCGTCCAGG + Exonic
947156272 2:227164913-227164935 CGGCTGCCGGGCTAGTGGCGAGG + Intronic
947741331 2:232486362-232486384 CGGCGGCGGCGCCTGTCCCGAGG - Exonic
1169029994 20:2399630-2399652 ACGCTGCCGCGCCAGTGCAGCGG - Exonic
1169244538 20:4015384-4015406 CGGCCGCCGCCCCCGGGCTGGGG - Intronic
1173633172 20:44531830-44531852 CCGCCGTAGCGCGAGTGCCGCGG + Intronic
1174380696 20:50153674-50153696 CGGCGGCGGCGGCAGGGCCGCGG + Exonic
1175847000 20:62064788-62064810 CGGCTGCGGCGCCGGCGCCGGGG - Exonic
1176283298 20:64327620-64327642 CGGCCGCCGCGTCAGCACCACGG - Intergenic
1176448112 21:6839849-6839871 CCGCCGCCGCCCCAGTGTCCGGG + Intergenic
1176826282 21:13704871-13704893 CCGCCGCCGCCCCAGTGTCCGGG + Intergenic
1180876725 22:19178326-19178348 CGGCCGCCGCGCCAGTGCCGCGG + Intronic
1180876831 22:19178620-19178642 CGGCCGCCGCGCCCGCGTCCGGG - Exonic
1181710690 22:24685928-24685950 CGGGAGCCAGGCCAGTGCCGCGG + Intergenic
1182380479 22:29883430-29883452 CAGCCGCCTGGCCAGGGCCGGGG - Intronic
1182903848 22:33920440-33920462 CCGCCGCCGCGCCGGAGCCCGGG - Intronic
1183683769 22:39350209-39350231 CCGCCGCCGCGCCGCCGCCGGGG - Intronic
1184035257 22:41915000-41915022 CGGAGGCCGCGCCGGGGCCGCGG + Intergenic
1185037930 22:48489457-48489479 CCGCCGCCGCGCCCGGGCCCCGG - Exonic
1185409537 22:50674647-50674669 CGGCCCCGGGGCCAGCGCCGTGG + Intergenic
958641532 3:96813496-96813518 CGGCCCCCGCCCCAGGGCCGGGG - Intergenic
966181902 3:177196555-177196577 GGGTCGCCGCGCCCGGGCCGGGG + Intronic
970202862 4:13627461-13627483 CGCCCGCCCCGCCCGCGCCGGGG + Exonic
981688515 4:147481252-147481274 CCGCCGCCGCGCCGGAGCCCGGG + Exonic
984206380 4:176792496-176792518 CGCCCTCCCAGCCAGTGCCGGGG + Exonic
985894942 5:2743378-2743400 CGGCCGCCGGGCAAGCGCCCCGG + Intergenic
998156281 5:139788699-139788721 CGGCCGCCGGCCCAGGGCCCCGG - Intergenic
998517628 5:142770374-142770396 CGGCCGCCCCGCCGGTGTCTGGG - Exonic
1005912995 6:30327008-30327030 CCGCCGCCGCGCCCGAGCCTGGG + Intronic
1007126906 6:39433122-39433144 TGGCTGCCGCCACAGTGCCGTGG - Intronic
1013330389 6:109094838-109094860 CCGCCGCCCCGCCAGCTCCGCGG - Intergenic
1013978190 6:116100725-116100747 CGCCCGCCGCGCGAGGGGCGGGG + Intergenic
1015149273 6:130020000-130020022 CGGCGGCCGCGCCGGGGCGGCGG + Intronic
1016454483 6:144216397-144216419 CGGCCGCCACGCCGGTACCTCGG - Intergenic
1019562532 7:1665763-1665785 TGGCGGCCGCGGCAGCGCCGAGG - Intergenic
1022018575 7:26376696-26376718 GGGCGGCCGCGCCGGGGCCGGGG + Intergenic
1023773692 7:43583343-43583365 CCGCCGCCGCCCCAGGCCCGCGG + Exonic
1026745092 7:73005531-73005553 CGGCCGCCGCGCGTGCGCAGTGG + Intergenic
1027031204 7:74890226-74890248 CGGCCGCCGCGCGTGCGCAGTGG + Intergenic
1027098648 7:75359549-75359571 CGGCCGCCGCGCGTGCGCAGTGG - Intergenic
1030597989 7:111562315-111562337 CGCCCGCCCCGCCGGGGCCGGGG + Intronic
1032077632 7:128843607-128843629 CGGCCGGCCCGCCAGAGCCCTGG + Intronic
1034264125 7:149773117-149773139 CGGCCGCTCCGCCCGCGCCGCGG + Exonic
1038311656 8:26449828-26449850 CGGTCCCCGCGCCATCGCCGCGG - Intronic
1038883614 8:31640106-31640128 CGCCCCCGGCGCCAGGGCCGCGG - Intronic
1041124456 8:54621336-54621358 CGGCTGCTGAGCCAGGGCCGCGG - Exonic
1049620938 8:143598010-143598032 CGCCCCCCGCGCCCGGGCCGCGG + Exonic
1050343323 9:4662507-4662529 CAGCAGCCGCGCCACGGCCGTGG + Exonic
1059769796 9:117414665-117414687 CGGCGCCCGCGCCGGGGCCGGGG - Exonic
1062230515 9:135479574-135479596 CTGCCGCCGCGCCCGCGCCCCGG - Intronic
1062578814 9:137220919-137220941 GGGCCGCCGTGGCAGTGGCGGGG + Exonic
1203521078 Un_GL000213v1:44669-44691 CCGCCGCCGCCCCAGTGTCCGGG - Intergenic
1187181486 X:16947053-16947075 CGGCCGCAGTGGCCGTGCCGGGG - Exonic
1196001983 X:110795952-110795974 GGGCCGCCGCGCCCGCGCCTTGG - Intergenic