ID: 1180876726

View in Genome Browser
Species Human (GRCh38)
Location 22:19178327-19178349
Sequence GGCCGCCGCGCCAGTGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 145}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180876714_1180876726 7 Left 1180876714 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 145
1180876709_1180876726 28 Left 1180876709 22:19178276-19178298 CCCGGCCGCTGGCGCTCGGGCCC 0: 1
1: 0
2: 3
3: 21
4: 209
Right 1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 145
1180876716_1180876726 6 Left 1180876716 22:19178298-19178320 CCTCCCCCGTCCCGGACTTCGGT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 145
1180876724_1180876726 -5 Left 1180876724 22:19178309-19178331 CCGGACTTCGGTCGGCGCGGCCG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 145
1180876723_1180876726 -4 Left 1180876723 22:19178308-19178330 CCCGGACTTCGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 145
1180876720_1180876726 1 Left 1180876720 22:19178303-19178325 CCCGTCCCGGACTTCGGTCGGCG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 145
1180876717_1180876726 3 Left 1180876717 22:19178301-19178323 CCCCCGTCCCGGACTTCGGTCGG 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 145
1180876711_1180876726 23 Left 1180876711 22:19178281-19178303 CCGCTGGCGCTCGGGCCCCTCCC 0: 1
1: 0
2: 2
3: 30
4: 311
Right 1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 145
1180876710_1180876726 27 Left 1180876710 22:19178277-19178299 CCGGCCGCTGGCGCTCGGGCCCC 0: 1
1: 0
2: 2
3: 35
4: 278
Right 1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 145
1180876713_1180876726 8 Left 1180876713 22:19178296-19178318 CCCCTCCCCCGTCCCGGACTTCG 0: 1
1: 0
2: 0
3: 21
4: 204
Right 1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 145
1180876721_1180876726 0 Left 1180876721 22:19178304-19178326 CCGTCCCGGACTTCGGTCGGCGC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 145
1180876719_1180876726 2 Left 1180876719 22:19178302-19178324 CCCCGTCCCGGACTTCGGTCGGC 0: 1
1: 0
2: 0
3: 4
4: 26
Right 1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180876726 Original CRISPR GGCCGCCGCGCCAGTGCCGC GGG Intronic
904403430 1:30271732-30271754 GGCCGAGGCGGCAGTGCCTCAGG - Intergenic
904576212 1:31506736-31506758 GGCCGCTGCACCAGTCCCCCTGG + Intergenic
904641953 1:31937943-31937965 GGCCCCCGCGCCGGCGCCGGGGG - Intronic
906318008 1:44800511-44800533 GGCCGCCGCGCCCGCTCCCCCGG + Exonic
911449569 1:98046056-98046078 GGCCGCTGCCCCCCTGCCGCTGG + Intergenic
912471711 1:109911163-109911185 GAACGCCGGGCCAGTGCAGCCGG - Intronic
913518264 1:119623296-119623318 CGCCGCCGCCCCCGCGCCGCTGG + Exonic
913565631 1:120069704-120069726 GGCCGCGGCGACAGTGGGGCGGG - Intergenic
913632498 1:120723849-120723871 GGCCGCGGCGACAGTGGGGCGGG + Intergenic
914286227 1:146229078-146229100 GGCCGCGGCGACAGTGGGGCGGG - Intergenic
914547255 1:148679820-148679842 GGCCGCGGCGACAGTGGGGCGGG - Intergenic
914619248 1:149390523-149390545 GGCCGCGGCGACAGTGGGGCGGG + Intergenic
919981106 1:202643386-202643408 GGCCGCAGCGGCAGGGCCGGCGG - Exonic
920848377 1:209612008-209612030 GGCCGCCGGCCCACTGCCCCTGG + Exonic
922239942 1:223748924-223748946 GGCCGCTGCGCTAGTGCGTCCGG + Intronic
1063418234 10:5890292-5890314 CGCCGCCGGGCCCGCGCCGCCGG - Intronic
1064237153 10:13587016-13587038 GGCCGCCGGCCCAGTGAGGCTGG + Exonic
1064478745 10:15719482-15719504 GGACTCCGCGGCAGAGCCGCTGG + Intronic
1069991550 10:72319643-72319665 GGCAGCCGGGCGAGGGCCGCGGG + Intergenic
1075370036 10:121927983-121928005 GGCGGCCGCGCTAGCGACGCGGG - Exonic
1076501293 10:130938217-130938239 CTCCGCCGCCCCAGTGCCTCAGG + Intergenic
1083965787 11:66042943-66042965 GCCGCCCGCGCCAGCGCCGCGGG + Exonic
1084000153 11:66291783-66291805 GGCGGCGCCGCCGGTGCCGCGGG + Intergenic
1084128675 11:67118136-67118158 TTCCGCCGCGCCGGTGCCCCCGG - Intergenic
1084891742 11:72240127-72240149 GCCCGCCGCGCCCTTGGCGCTGG + Exonic
1085294829 11:75425479-75425501 GGCCGCCGCGCCCCTCCCGGAGG - Exonic
1085504088 11:77046177-77046199 GAGCGCCGGGCCAGTGCCGTGGG - Intergenic
1090817914 11:130314829-130314851 CGCCGCCGCGCGCGTGCGGCCGG + Intergenic
1091273255 11:134332402-134332424 CCCCGCCGCGCCTGTGACGCCGG + Intronic
1096482414 12:51951585-51951607 GGCCGCGGCGCCGGCTCCGCCGG + Intergenic
1097187485 12:57203507-57203529 GGGCGCACCGCCAGTGCCGCAGG - Exonic
1101592719 12:106138623-106138645 GGCCGCCGCGCCTGTGGCGGGGG - Exonic
1101910476 12:108857368-108857390 GGACGCCGCGCCGAGGCCGCCGG - Intronic
1102854152 12:116278094-116278116 GGCCGCCGCGCCACGCCAGCCGG - Intergenic
1103407659 12:120687186-120687208 GGCCGCTCCGCCTGAGCCGCCGG - Exonic
1103474811 12:121210435-121210457 AGCCGCCGCGCCGGGGCCCCGGG + Intronic
1105349452 13:19602280-19602302 CGCCGCCGCACACGTGCCGCGGG + Intergenic
1111006636 13:82258058-82258080 GGCCGGCGCGGCCGGGCCGCAGG + Intergenic
1111672763 13:91348995-91349017 GGTCGCCGCGCGGCTGCCGCCGG + Intergenic
1114659403 14:24334986-24335008 CTCCGCTGCGCCAGCGCCGCGGG - Exonic
1115770112 14:36658747-36658769 GTCAGCCGTCCCAGTGCCGCGGG - Intronic
1118627798 14:67674842-67674864 GGCCGCGCTGCCAGTCCCGCAGG - Intronic
1122221035 14:100239211-100239233 GGCCGCCGCGGCCGTGGCGGCGG + Exonic
1122418380 14:101560989-101561011 GGCCGCTGCCCAGGTGCCGCGGG - Intergenic
1122540213 14:102493773-102493795 GGGAGCCGCGCCTGTGCTGCAGG - Intronic
1122996829 14:105269673-105269695 GGCAGCCCCGGCAGTGCCACAGG + Intronic
1123750463 15:23354997-23355019 GGCCCCCACACCAGTGCCTCTGG + Intronic
1124118457 15:26868074-26868096 GGCCGGCGCGCCAGGGCAGGTGG - Intronic
1124469367 15:29969097-29969119 GGCCCCCGCTCCGGAGCCGCTGG + Intergenic
1124496799 15:30192116-30192138 GGCCGCAGCGGCAGGGCCGGCGG - Intergenic
1124629238 15:31327535-31327557 GGCCGCCGCGCCTTCGGCGCCGG - Exonic
1124746777 15:32346531-32346553 GGCCGCAGCGGCAGGGCCGGCGG + Intergenic
1125882940 15:43209331-43209353 GGCCGGTGAGCCACTGCCGCAGG + Exonic
1127449812 15:59105427-59105449 GGCCGCAGGGCCAGGGACGCGGG - Intronic
1127606310 15:60591823-60591845 GCCGGCCGGGCAAGTGCCGCAGG - Intronic
1128423982 15:67521225-67521247 GCCCGCCGCGCCGGGGACGCAGG - Exonic
1132856439 16:2047181-2047203 GGCCTCTGCGCTAGTCCCGCTGG - Intronic
1133259468 16:4538706-4538728 GGCCGCTGCCCCAGGGCTGCGGG - Intronic
1137617629 16:49856714-49856736 GGCAGGCGCGCCCGTGCCCCGGG + Intronic
1141482008 16:84313083-84313105 AGCAGCAGCGCCGGTGCCGCGGG - Exonic
1142336306 16:89491220-89491242 GGCCGCGGCTCCAGAGCCCCTGG + Intronic
1142560391 17:806034-806056 GAGCGCAGGGCCAGTGCCGCCGG + Intronic
1144825920 17:18105715-18105737 GGCCTCCGCCCCAGGGACGCTGG + Intronic
1148323679 17:46771635-46771657 GGCCGCCGGGCCCGGGCCGCCGG + Intronic
1149099187 17:52883919-52883941 GGATGCCGCACCAGGGCCGCAGG + Intronic
1149263108 17:54900537-54900559 GGCGGCCGCGCCACTCTCGCAGG + Exonic
1152729356 17:81961930-81961952 GGCCCCGGCGCCACTGCTGCCGG - Intergenic
1157613966 18:48976061-48976083 GGGCGCCGCGCGGGTGGCGCAGG + Intergenic
1160558159 18:79739543-79739565 GGAAGCCGCGCCAGAGCCGAGGG - Intronic
1160706294 19:531748-531770 GGCGGCGGCGCCAGAGCTGCTGG + Exonic
1160823447 19:1068528-1068550 AGCCGCCACGCCAGCGCGGCTGG + Exonic
1161156037 19:2732337-2732359 GGCCGCGCCGCCTGTGCCTCAGG - Intronic
1162128447 19:8511650-8511672 GGCCGCTGCACCCGGGCCGCCGG - Exonic
1162398374 19:10430836-10430858 CGCGGCCGCGCCATGGCCGCGGG - Intronic
1165080609 19:33303848-33303870 GGCCTCAGCGCCAGTGGCGAGGG - Intergenic
1165463703 19:35959637-35959659 GACCGCCGCCCCAGGGTCGCTGG + Intergenic
1165860708 19:38907773-38907795 GGCAGCAGCGCCAGTGACACGGG + Intronic
927204252 2:20597069-20597091 GGCCGCCACTCCAGGGCCCCAGG + Intronic
929604863 2:43227212-43227234 GGCCGCCGCGGCAGTCTTGCCGG + Intergenic
932757059 2:74416157-74416179 GCCCACTGTGCCAGTGCCGCAGG - Exonic
934966859 2:98731127-98731149 GGCCGCCCCGCCCGCCCCGCCGG + Intergenic
937044985 2:118846534-118846556 GGCCGCGGCGGCAGTGGCGGCGG - Exonic
948727579 2:239944356-239944378 GGCCCCAGGGCCAGCGCCGCAGG + Intronic
948870520 2:240795676-240795698 GGCCGCCTACCCAGTGCCCCTGG + Intronic
1169029993 20:2399629-2399651 CGCTGCCGCGCCAGTGCAGCGGG - Exonic
1169204568 20:3732602-3732624 GGCCGCGCCGCCTGCGCCGCCGG - Intergenic
1173633173 20:44531831-44531853 CGCCGTAGCGCGAGTGCCGCGGG + Intronic
1174317531 20:49713948-49713970 GGAGGCGGGGCCAGTGCCGCCGG + Intergenic
1175777595 20:61662996-61663018 GGCCGCTGTGCCAGTGCCTGTGG - Intronic
1175993307 20:62800522-62800544 GGCGGCCGCCCCAGTGCTGATGG + Exonic
1176382392 21:6119895-6119917 GTCCGCCACCCCAGTGCTGCAGG + Exonic
1179741080 21:43418344-43418366 GTCCGCCACCCCAGTGCTGCAGG - Exonic
1180560359 22:16610158-16610180 GGCCGAGGCGCCGGAGCCGCAGG - Intergenic
1180876726 22:19178327-19178349 GGCCGCCGCGCCAGTGCCGCGGG + Intronic
1184035258 22:41915001-41915023 GGAGGCCGCGCCGGGGCCGCGGG + Intergenic
1184503526 22:44888041-44888063 GGCCCCCGGGCAGGTGCCGCAGG + Exonic
1184688502 22:46107108-46107130 TGCGGCCGAGCCAGAGCCGCAGG + Intronic
1185038197 22:48490340-48490362 CGCGCCCGCGCCAGTCCCGCCGG - Intronic
950438509 3:12994213-12994235 GGCCGCCCCGCCGGTGGCGCTGG - Intronic
954664738 3:52245813-52245835 TGCCGCCGCGCCATGTCCGCCGG + Intronic
964983081 3:162710451-162710473 GGATCCCGCGCCAGGGCCGCAGG + Intergenic
966743529 3:183254483-183254505 GGCCGCCGCCCAGGTGCGGCAGG + Intronic
969361215 4:6664824-6664846 CGCGGCCGGGCCAGAGCCGCTGG - Intergenic
971352108 4:25863499-25863521 GGCCGGGGCGCCATTCCCGCAGG + Intronic
977323586 4:95548738-95548760 GGCGGCGGAGCCAGTGCCGCTGG + Exonic
984167531 4:176320297-176320319 GGCTGCCGTGCCGGGGCCGCGGG + Intronic
986330815 5:6714632-6714654 GGCCGCGGCGCCTGGGCCCCGGG - Exonic
987050470 5:14143766-14143788 GGCCGCCGCGGCGGGGCCGGAGG - Exonic
992527659 5:77628366-77628388 GCCCTCCGCGCCACTGCCCCAGG + Intergenic
994043576 5:95284533-95284555 GGCGGGCGAGCCAGAGCCGCCGG - Exonic
997302024 5:132813457-132813479 CTCGGTCGCGCCAGTGCCGCTGG - Intergenic
997704111 5:135930633-135930655 GGCGGCCGGGCCCGGGCCGCGGG - Intronic
999144037 5:149381002-149381024 GGCCGCCCGGCCAGTGGGGCTGG - Intronic
1000463408 5:161548177-161548199 GGCCGCCTCGCCGTGGCCGCCGG + Intronic
1002209832 5:177592079-177592101 TACTGCCGCGCCAGGGCCGCGGG + Intergenic
1003139151 6:3456741-3456763 GGCCGCAGCGCCCGGGGCGCGGG - Intronic
1003175849 6:3751813-3751835 GCCCGCGGCGCCCGTTCCGCGGG - Exonic
1004216870 6:13711565-13711587 GGCCGCAGCGACAGCGCCCCCGG - Intergenic
1005474992 6:26199087-26199109 GGCCGGCGCGCCAGTGTATCTGG - Exonic
1006320729 6:33317799-33317821 GGGCACCCCGCCCGTGCCGCTGG + Intronic
1006472773 6:34237650-34237672 GGCCGCCGCGCGAGGTGCGCCGG - Intronic
1007126905 6:39433121-39433143 GGCTGCCGCCACAGTGCCGTGGG - Intronic
1015149274 6:130020001-130020023 GGCGGCCGCGCCGGGGCGGCGGG + Intronic
1015732252 6:136360962-136360984 GGCCCCGGCCCCAGTCCCGCAGG - Intronic
1016965872 6:149718128-149718150 GGCCCCCGCGCAAGCGACGCCGG - Exonic
1017929408 6:158939173-158939195 GGCCGCAGTGCCGGGGCCGCAGG - Intergenic
1018388786 6:163327696-163327718 GGCCACAGCCCCAGTGCAGCGGG + Intergenic
1018650320 6:165987125-165987147 GGCTGCCGCGCCAGACCCGCAGG - Intergenic
1019332076 7:465159-465181 GTCCGCCTCCCCAGGGCCGCCGG + Intergenic
1019894855 7:3975856-3975878 GACCCCCGCACCACTGCCGCCGG - Intronic
1020008072 7:4792677-4792699 GGCCGCTGAGCCGGGGCCGCAGG + Intronic
1022093264 7:27122195-27122217 GGCCGCCGCGCCCGTGCCCGTGG + Intronic
1023773693 7:43583344-43583366 CGCCGCCGCCCCAGGCCCGCGGG + Exonic
1034264126 7:149773118-149773140 GGCCGCTCCGCCCGCGCCGCGGG + Exonic
1034267975 7:149790332-149790354 GGTCGCAGCGCCAGCCCCGCGGG - Intergenic
1034470436 7:151251841-151251863 GGCGGCCGAGCCCGTCCCGCAGG - Intronic
1034488686 7:151381587-151381609 CGCCGCCGCGCCCCTGCAGCCGG - Exonic
1034546127 7:151790604-151790626 GGCCGCAGAGTCTGTGCCGCTGG + Intronic
1038267501 8:26047863-26047885 GCCCCCCGCGGCAGTGCTGCTGG + Intergenic
1038726006 8:30083108-30083130 GGCCGCAGCGGCAGTGACGTAGG - Exonic
1040568002 8:48583683-48583705 GGCCGCCGGGCCTGAGCCCCAGG - Intergenic
1041124455 8:54621335-54621357 GGCTGCTGAGCCAGGGCCGCGGG - Exonic
1044988587 8:97775922-97775944 GCCCGCCGCGCCGCTGCTGCCGG - Exonic
1049231545 8:141487492-141487514 GGGCACCGTGCCAGTGACGCAGG - Intergenic
1049689832 8:143953587-143953609 GGTCGCTGAGCCAGAGCCGCAGG - Intronic
1052014832 9:23452126-23452148 GAGCGCCCGGCCAGTGCCGCTGG + Intergenic
1056126231 9:83538383-83538405 GCCCGCCGCGCCCCGGCCGCTGG - Exonic
1062113183 9:134793532-134793554 GGCCCCAGCGCCTGTGCCTCGGG + Intronic
1062230514 9:135479573-135479595 TGCCGCCGCGCCCGCGCCCCGGG - Intronic
1062363981 9:136200199-136200221 GGCCACTGGGCCAGAGCCGCTGG + Intronic
1062600318 9:137316303-137316325 GGCCGGCGCGCGAAGGCCGCGGG - Intronic
1203739974 Un_GL000216v2:170756-170778 TGCCTCCGCGCCACTGTCGCCGG - Intergenic
1195625219 X:106999925-106999947 GCCCGGCGCGCCAGGGCCGGCGG + Exonic
1199736841 X:150693475-150693497 GGCCGCCGCTCCCGTCCCGACGG + Exonic