ID: 1180876727

View in Genome Browser
Species Human (GRCh38)
Location 22:19178328-19178350
Sequence GCCGCCGCGCCAGTGCCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 124}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180876713_1180876727 9 Left 1180876713 22:19178296-19178318 CCCCTCCCCCGTCCCGGACTTCG 0: 1
1: 0
2: 0
3: 21
4: 204
Right 1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
1180876710_1180876727 28 Left 1180876710 22:19178277-19178299 CCGGCCGCTGGCGCTCGGGCCCC 0: 1
1: 0
2: 2
3: 35
4: 278
Right 1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
1180876720_1180876727 2 Left 1180876720 22:19178303-19178325 CCCGTCCCGGACTTCGGTCGGCG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
1180876716_1180876727 7 Left 1180876716 22:19178298-19178320 CCTCCCCCGTCCCGGACTTCGGT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
1180876714_1180876727 8 Left 1180876714 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
1180876723_1180876727 -3 Left 1180876723 22:19178308-19178330 CCCGGACTTCGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
1180876709_1180876727 29 Left 1180876709 22:19178276-19178298 CCCGGCCGCTGGCGCTCGGGCCC 0: 1
1: 0
2: 3
3: 21
4: 209
Right 1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
1180876719_1180876727 3 Left 1180876719 22:19178302-19178324 CCCCGTCCCGGACTTCGGTCGGC 0: 1
1: 0
2: 0
3: 4
4: 26
Right 1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
1180876721_1180876727 1 Left 1180876721 22:19178304-19178326 CCGTCCCGGACTTCGGTCGGCGC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
1180876711_1180876727 24 Left 1180876711 22:19178281-19178303 CCGCTGGCGCTCGGGCCCCTCCC 0: 1
1: 0
2: 2
3: 30
4: 311
Right 1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
1180876717_1180876727 4 Left 1180876717 22:19178301-19178323 CCCCCGTCCCGGACTTCGGTCGG 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 124
1180876724_1180876727 -4 Left 1180876724 22:19178309-19178331 CCGGACTTCGGTCGGCGCGGCCG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180876727 Original CRISPR GCCGCCGCGCCAGTGCCGCG GGG Intronic
900515212 1:3078493-3078515 ACCTCCGCGCCAGTGCAGAGAGG - Intronic
901324889 1:8360283-8360305 GCCGCCGCACCAGAGCAGGGTGG + Exonic
901641381 1:10694714-10694736 GCCGCCCTGCCAGTGCGGCGCGG - Intronic
901880647 1:12191880-12191902 GCCGCTGCGCAAGTGCCGCCCGG + Exonic
903976755 1:27155021-27155043 CGCGTCGCGCCAGGGCCGCGAGG - Intronic
906142307 1:43540953-43540975 GCCGCTGCTGCAGTGCCACGCGG + Intronic
910449117 1:87329017-87329039 GCCCCCGCGTAAGTGCCGGGCGG - Exonic
910981113 1:92961154-92961176 GCCGCGGCGCGGGAGCCGCGAGG + Intronic
913565630 1:120069703-120069725 GCCGCGGCGACAGTGGGGCGGGG - Intergenic
913632499 1:120723850-120723872 GCCGCGGCGACAGTGGGGCGGGG + Intergenic
914286226 1:146229077-146229099 GCCGCGGCGACAGTGGGGCGGGG - Intergenic
914547254 1:148679819-148679841 GCCGCGGCGACAGTGGGGCGGGG - Intergenic
914619249 1:149390524-149390546 GCCGCGGCGACAGTGGGGCGGGG + Intergenic
915142402 1:153775707-153775729 GCTGCTGGGCCAGTTCCGCGAGG - Exonic
919101804 1:193105349-193105371 GCGTCCCCGCCAGCGCCGCGCGG + Intronic
919916925 1:202144616-202144638 GCCGCAGCGCGAGGGCAGCGAGG - Exonic
921866702 1:220094235-220094257 GCGGCCGCGCCCGGCCCGCGAGG - Exonic
1075370035 10:121927982-121928004 GCGGCCGCGCTAGCGACGCGGGG - Exonic
1079459774 11:20669507-20669529 GCCGCCGCGCCAGCGGTGGGGGG + Intergenic
1081209471 11:40313897-40313919 GCCGCCGCGCCCGGCCCGTGGGG + Intronic
1083680814 11:64351156-64351178 GCAGCTGCGCCAGGGCCCCGCGG + Exonic
1083922140 11:65786830-65786852 GCCGCCCCGCCCGGGCCGCGAGG + Intergenic
1083965789 11:66042944-66042966 CCGCCCGCGCCAGCGCCGCGGGG + Exonic
1084000154 11:66291784-66291806 GCGGCGCCGCCGGTGCCGCGGGG + Intergenic
1084195829 11:67523291-67523313 GCCCCGGCGCCAGGGCCGCTTGG + Exonic
1085504087 11:77046176-77046198 AGCGCCGGGCCAGTGCCGTGGGG - Intergenic
1090784104 11:130033239-130033261 GCGGCCGCGCCGGCGCAGCGAGG - Intergenic
1091273257 11:134332403-134332425 CCCGCCGCGCCTGTGACGCCGGG + Intronic
1098024737 12:66189519-66189541 GAGGCCGCGCCAGCCCCGCGAGG - Intronic
1103342753 12:120229885-120229907 GCCCCAGCGCCAGGGCCCCGTGG + Intronic
1103474812 12:121210436-121210458 GCCGCCGCGCCGGGGCCCCGGGG + Intronic
1103581496 12:121918727-121918749 GCCCCCTCGCCAGGGCCGCGTGG - Intronic
1112722487 13:102260409-102260431 GCTGCCACGCCAGTGCCTGGAGG - Intronic
1113378907 13:109786069-109786091 GGCGCCGGGCCCGGGCCGCGCGG - Exonic
1115768482 14:36647323-36647345 CCCGCCGCGCCAGCACCGTGGGG + Intergenic
1117803043 14:59464678-59464700 GAAGCCGCGCCAGGGCCCCGCGG + Exonic
1120914808 14:89701692-89701714 GCCGGCGCGCCAGCGGGGCGGGG + Intergenic
1122602937 14:102930295-102930317 GCCGCCGCTGCTGCGCCGCGCGG + Exonic
1122942044 14:104985849-104985871 GCCGCCTCGGCGGGGCCGCGCGG - Exonic
1125508915 15:40282594-40282616 GCCGCCGCGCCCGGGCAGCCTGG + Intronic
1132252089 15:100341727-100341749 GCCGCCGCCCCCGGGCCGCCAGG + Intronic
1132738601 16:1399441-1399463 GCCGCCACGCCTGTGCCGCCAGG - Exonic
1132851540 16:2027026-2027048 GCGGCCGCGCCTGTGCCGCTTGG + Exonic
1132971546 16:2691652-2691674 CCCGCCGCCCCAGTGCCTCCAGG - Intronic
1133020270 16:2964053-2964075 GCCTCCGCTCCAGTGCTGGGCGG + Exonic
1133259467 16:4538705-4538727 GCCGCTGCCCCAGGGCTGCGGGG - Intronic
1139549731 16:67666669-67666691 GCCCCTGCCCGAGTGCCGCGGGG - Exonic
1142550012 17:732609-732631 GCCGCCTCGCTGGCGCCGCGTGG - Exonic
1142836791 17:2593577-2593599 GCCGCCGCCCCAGACCCGCCAGG - Intronic
1143411756 17:6713464-6713486 GGCCCCGCCCCAGGGCCGCGGGG - Exonic
1146492652 17:33293231-33293253 CCAGCCGCGCCAGCGTCGCGCGG - Intronic
1146759088 17:35460548-35460570 GCCGCAGCTCCGGTGACGCGAGG + Intergenic
1148081202 17:44968406-44968428 CCCGCCCCGCCAGCTCCGCGCGG + Intergenic
1148323680 17:46771636-46771658 GCCGCCGGGCCCGGGCCGCCGGG + Intronic
1149997163 17:61411396-61411418 CCCGCCGCTCCGGTGCCGCAAGG + Intergenic
1152581169 17:81166181-81166203 CCCGCGGCGCCAGGGCCGGGCGG - Intergenic
1152596330 17:81239458-81239480 GCGGGCGGGCCAGTGCTGCGGGG + Intronic
1152714360 17:81891408-81891430 GCCGCCGCGCGAGTGAATCGAGG - Exonic
1157609706 18:48948849-48948871 TCCCCCGCGCGAGTGCCGAGCGG - Intronic
1157794116 18:50559646-50559668 GCCGCCCCGCCAGCCCCGCGCGG - Intergenic
1158478797 18:57803102-57803124 GCCGCCGCGCTAGCGCTGCATGG + Intergenic
1160558158 18:79739542-79739564 GAAGCCGCGCCAGAGCCGAGGGG - Intronic
1160565246 18:79783000-79783022 CCTGCCGCGCCAGAGCCGAGAGG - Intergenic
1160807886 19:1000611-1000633 GCCGCGGCGCCAGGGCGGCCCGG - Exonic
1162299331 19:9835391-9835413 GCCGCAGCTCAGGTGCCGCGGGG + Exonic
1162398373 19:10430835-10430857 GCGGCCGCGCCATGGCCGCGGGG - Intronic
1162419911 19:10560233-10560255 GCCTCCTGGCCAGTGCCGCCTGG + Intronic
1163443693 19:17334420-17334442 GCCGCAGCCGCAGTGCCGGGAGG + Intronic
1163777117 19:19225155-19225177 GACGCCGCGCCGGCGCTGCGGGG + Exonic
1165080608 19:33303847-33303869 GCCTCAGCGCCAGTGGCGAGGGG - Intergenic
1165860709 19:38907774-38907796 GCAGCAGCGCCAGTGACACGGGG + Intronic
1166996263 19:46721050-46721072 GCTGCAGCGTCAGTGCTGCGGGG - Intronic
925177876 2:1797871-1797893 ACCGCCGCGCCTGTGCCGGATGG - Intronic
925177913 2:1797990-1798012 ACCGCCGCGCCTGTGCCGGATGG - Intronic
925177923 2:1798019-1798041 ACCGCCGCGCCTGTGCCGGATGG - Intronic
925177940 2:1798078-1798100 ACCGCCGCGCCTGTGCCGGATGG - Intronic
925177955 2:1798137-1798159 ACCGCCGCGCCTGTGCCGGATGG - Intronic
925177963 2:1798166-1798188 ACCGCCGCGCCTGTGCCGGATGG - Intronic
925177978 2:1798225-1798247 ACCGCCGCGCCTGTGCCGGATGG - Intronic
927652203 2:24919782-24919804 GCCGCCCCGGCAGCGCCTCGGGG + Exonic
928518328 2:32064141-32064163 GCCCCGGCGCCGGTGCCGGGCGG + Exonic
934754691 2:96816834-96816856 GCAGCCGGCCCAGCGCCGCGCGG - Exonic
940751160 2:157628654-157628676 GCGGCCGCGCCGGGGCTGCGAGG + Exonic
942455709 2:176136865-176136887 GAAGCCGCGCCAGAACCGCGCGG - Intergenic
944615199 2:201452122-201452144 GCCACTGCGCCAGTGCAGCTCGG + Intronic
947815674 2:233034712-233034734 GCCGCCGCCCCAGGGCTGCCAGG + Exonic
948828733 2:240587007-240587029 GCCGCTGGCCCAGTTCCGCGAGG + Exonic
1170999101 20:21396150-21396172 GCCGCCGTCCCCGCGCCGCGTGG - Exonic
1173251458 20:41366240-41366262 GCCGCCGCGCCAGGCCCCCTCGG + Intronic
1173690857 20:44960128-44960150 GCCGCCGCGCGAGGCCCGGGCGG + Intronic
1174204253 20:48827775-48827797 GCCGCGGCGCCAGGGGCCCGGGG + Exonic
1175562046 20:59939262-59939284 GCCACCGCGCCACCGCCTCGTGG + Exonic
1175847250 20:62065408-62065430 GCCGCCGCCCGAGGGCAGCGCGG - Exonic
1176868660 21:14070783-14070805 ACCGCCACTCCAGGGCCGCGGGG - Intergenic
1180876727 22:19178328-19178350 GCCGCCGCGCCAGTGCCGCGGGG + Intronic
1180977218 22:19855030-19855052 GCTGGCGCGGCAGTGCCGCGCGG + Intergenic
1181277315 22:21695063-21695085 GCAGCCACGTGAGTGCCGCGGGG + Exonic
966886442 3:184380164-184380186 GGGGCCGGGGCAGTGCCGCGAGG - Exonic
969288303 4:6222077-6222099 GCCGCTGCGCCCGGGTCGCGTGG - Intergenic
969361214 4:6664823-6664845 GCGGCCGGGCCAGAGCCGCTGGG - Intergenic
978384607 4:108167524-108167546 GCCGCTGCCCCAGTTCCGAGAGG - Intronic
985558930 5:571944-571966 GCCGCGGCTCCAGGTCCGCGTGG - Intergenic
986330814 5:6714631-6714653 GCCGCGGCGCCTGGGCCCCGGGG - Exonic
988726954 5:33936061-33936083 CCAGCCGCGCCCGCGCCGCGAGG - Intergenic
990557745 5:56952195-56952217 GCCGCCGGGCGGGTGCCGGGCGG - Intronic
990910003 5:60843761-60843783 TCCGCAGGGCCAGCGCCGCGCGG + Intronic
997302023 5:132813456-132813478 TCGGTCGCGCCAGTGCCGCTGGG - Intergenic
997635124 5:135399047-135399069 GCCGCCGCGTAAGTGCCGCGCGG - Exonic
997635181 5:135399308-135399330 GCCTCCGCGCCCGTGCCGCCCGG + Exonic
1003139150 6:3456740-3456762 GCCGCAGCGCCCGGGGCGCGGGG - Intronic
1003290683 6:4776293-4776315 GCCGCCCCGCCCCTCCCGCGCGG + Intronic
1006725416 6:36196555-36196577 GCCGCCGCGCCAGGCACGGGCGG + Intergenic
1007465566 6:42048880-42048902 GCCCCCGCACCTATGCCGCGTGG - Intronic
1010414937 6:75602070-75602092 CCCGCCGCGCCGGAGCGGCGAGG - Exonic
1015910273 6:138162193-138162215 GCCGCGGCGGGAGGGCCGCGCGG + Intronic
1016340891 6:143060753-143060775 GCGGCCGCGCCAGTCCCCGGGGG + Intronic
1017954878 6:159169442-159169464 CCCGCCGCGCCCCTGCCCCGCGG - Exonic
1019634178 7:2066801-2066823 GCAGCAGCACCAGTGTCGCGTGG + Intronic
1019634674 7:2069223-2069245 GCCTCCGGGCCAGCGCCTCGTGG + Exonic
1025261840 7:57425286-57425308 GCAGGAGCGCCAGTGCCGCCTGG + Intergenic
1025739160 7:64182503-64182525 GCAGGAGCGCCAGTGCCGCCTGG + Intronic
1034264127 7:149773119-149773141 GCCGCTCCGCCCGCGCCGCGGGG + Exonic
1034267974 7:149790331-149790353 GTCGCAGCGCCAGCCCCGCGGGG - Intergenic
1036659341 8:10697964-10697986 GCCGCCGCGCCTGCGCAGCCCGG + Exonic
1037703305 8:21295190-21295212 GCCGCTGCCCCAGTGCCTGGGGG + Intergenic
1038017596 8:23528801-23528823 GCCGCCGCGCCATTGGTGTGCGG - Exonic
1038326685 8:26577492-26577514 GCCGCCGCGGCAGCCCCGCGTGG - Intronic
1045112016 8:98945185-98945207 GCAGCCGCGGCAGCGCAGCGTGG + Intronic
1046132280 8:109980758-109980780 GCCACCGCGCCCGGCCCGCGAGG + Intergenic
1049508999 8:143018474-143018496 GCCCCCGCCCCGGGGCCGCGCGG + Intronic
1053306155 9:36986139-36986161 GCCGCCGCGCCCGCGCCCCCCGG + Intronic
1060481279 9:124017985-124018007 GCGGCCGCGGGAGTCCCGCGCGG + Intronic
1061541022 9:131277837-131277859 GCCGCCGCGCCGCTGCCGCCTGG + Intergenic
1062230513 9:135479572-135479594 GCCGCCGCGCCCGCGCCCCGGGG - Intronic
1062574534 9:137200161-137200183 CCCGCCGCGCCCGGGCCCCGCGG - Exonic
1192212524 X:69136961-69136983 GCCCCGCCCCCAGTGCCGCGTGG + Intergenic
1198051532 X:132956974-132956996 GCAGCCGTGCGAGTGCCGCGTGG - Exonic
1200251636 X:154557243-154557265 GGCTCCCCGCCAGGGCCGCGAGG + Intronic
1200253843 X:154568927-154568949 GGCTCCCCGCCAGGGCCGCGAGG + Intergenic
1200263926 X:154635481-154635503 GGCTCCCCGCCAGGGCCGCGAGG - Intergenic
1200266131 X:154647173-154647195 GGCTCCCCGCCAGGGCCGCGAGG - Intergenic