ID: 1180876730

View in Genome Browser
Species Human (GRCh38)
Location 22:19178336-19178358
Sequence GCCAGTGCCGCGGGGAACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 73}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180876721_1180876730 9 Left 1180876721 22:19178304-19178326 CCGTCCCGGACTTCGGTCGGCGC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73
1180876717_1180876730 12 Left 1180876717 22:19178301-19178323 CCCCCGTCCCGGACTTCGGTCGG 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73
1180876714_1180876730 16 Left 1180876714 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73
1180876713_1180876730 17 Left 1180876713 22:19178296-19178318 CCCCTCCCCCGTCCCGGACTTCG 0: 1
1: 0
2: 0
3: 21
4: 204
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73
1180876716_1180876730 15 Left 1180876716 22:19178298-19178320 CCTCCCCCGTCCCGGACTTCGGT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73
1180876719_1180876730 11 Left 1180876719 22:19178302-19178324 CCCCGTCCCGGACTTCGGTCGGC 0: 1
1: 0
2: 0
3: 4
4: 26
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73
1180876720_1180876730 10 Left 1180876720 22:19178303-19178325 CCCGTCCCGGACTTCGGTCGGCG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73
1180876724_1180876730 4 Left 1180876724 22:19178309-19178331 CCGGACTTCGGTCGGCGCGGCCG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73
1180876723_1180876730 5 Left 1180876723 22:19178308-19178330 CCCGGACTTCGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180876730 Original CRISPR GCCAGTGCCGCGGGGAACAT AGG Intronic