ID: 1180876730

View in Genome Browser
Species Human (GRCh38)
Location 22:19178336-19178358
Sequence GCCAGTGCCGCGGGGAACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 73}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180876723_1180876730 5 Left 1180876723 22:19178308-19178330 CCCGGACTTCGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73
1180876716_1180876730 15 Left 1180876716 22:19178298-19178320 CCTCCCCCGTCCCGGACTTCGGT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73
1180876714_1180876730 16 Left 1180876714 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73
1180876724_1180876730 4 Left 1180876724 22:19178309-19178331 CCGGACTTCGGTCGGCGCGGCCG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73
1180876717_1180876730 12 Left 1180876717 22:19178301-19178323 CCCCCGTCCCGGACTTCGGTCGG 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73
1180876720_1180876730 10 Left 1180876720 22:19178303-19178325 CCCGTCCCGGACTTCGGTCGGCG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73
1180876721_1180876730 9 Left 1180876721 22:19178304-19178326 CCGTCCCGGACTTCGGTCGGCGC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73
1180876713_1180876730 17 Left 1180876713 22:19178296-19178318 CCCCTCCCCCGTCCCGGACTTCG 0: 1
1: 0
2: 0
3: 21
4: 204
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73
1180876719_1180876730 11 Left 1180876719 22:19178302-19178324 CCCCGTCCCGGACTTCGGTCGGC 0: 1
1: 0
2: 0
3: 4
4: 26
Right 1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG 0: 1
1: 0
2: 1
3: 2
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180876730 Original CRISPR GCCAGTGCCGCGGGGAACAT AGG Intronic
900365756 1:2311327-2311349 GCGTGGGCCGAGGGGAACATGGG + Intergenic
917795140 1:178527926-178527948 GGCAGTGCAGCGGGGATGATGGG - Intronic
920380234 1:205530783-205530805 GCCAGTGGTGGGGGGACCATGGG - Intronic
921177951 1:212609506-212609528 GCCAGTGCTGCGGGGTACCCAGG - Intronic
922904532 1:229163873-229163895 GCCAGTGGTAAGGGGAACATGGG - Intergenic
1062788581 10:285733-285755 GCCAGTGCGGAGGGGCACAGTGG + Intronic
1064598960 10:16973932-16973954 GACAGTGCCGCGATGAACACGGG + Intronic
1071600443 10:86956253-86956275 GGCAGTGGCGTGGGGAACAGTGG - Intronic
1076414725 10:130277565-130277587 GGCAGTGCCGCAGGGAATACAGG - Intergenic
1077148670 11:1058001-1058023 GACAGCGCTGCGGCGAACATGGG + Intergenic
1077564370 11:3287480-3287502 GACAGTGCTGCAGTGAACATGGG + Intergenic
1077570260 11:3333297-3333319 GACAGTGCTGCAGTGAACATGGG + Intergenic
1079734988 11:23985841-23985863 AACAGTGCTGCGGTGAACATCGG + Intergenic
1085461494 11:76696674-76696696 GCCAGCGCCCCAGGGAAGATTGG + Intergenic
1088654218 11:111984004-111984026 GCCAGGGCCGCGGGGAGCTAAGG - Intronic
1103901595 12:124306360-124306382 GCCAGTGCAGCAGGGAACAGCGG + Intronic
1103972798 12:124682526-124682548 GCCAGTGCAGAGGGGCACCTGGG - Intergenic
1105765288 13:23553361-23553383 GCCTGTCCCCCAGGGAACATGGG + Intergenic
1108358914 13:49652009-49652031 CCCAGTGCCATGGGGAACAGTGG - Intergenic
1121437787 14:93930318-93930340 GACAGTGCAGAGGGGAGCATTGG + Intergenic
1121441099 14:93949900-93949922 GCCTGAGCAGTGGGGAACATAGG - Intronic
1123155337 14:106219245-106219267 TCCAGCGCCACTGGGAACATTGG + Intergenic
1123401999 15:19996372-19996394 TCCAGTGCCACTGGGAACACTGG + Intergenic
1123511339 15:21003036-21003058 TCCAGTGCCACTGGGAACACTGG + Intergenic
1123578173 15:21693807-21693829 TCCAGTGCCACTGGGAACACTGG + Intergenic
1123614798 15:22136289-22136311 TCCAGTGCCACTGGGAACACTGG + Intergenic
1128714181 15:69894983-69895005 ACCAGTGCCCAGGGTAACATAGG - Intergenic
1129230305 15:74193584-74193606 CCCAGTGCCGCGGGTATCCTGGG + Intronic
1202987043 15_KI270727v1_random:428052-428074 TCCAGTGCCACTGGGAACACTGG + Intergenic
1132733598 16:1375042-1375064 GTCAGCGCCACGGGGACCATGGG + Intronic
1137521934 16:49202015-49202037 GCCACTGTCTTGGGGAACATGGG - Intergenic
1138783677 16:59820210-59820232 GACAGTGCTGCAGTGAACATGGG - Intergenic
1144388253 17:14770194-14770216 GCCACTGCCCTGGGGAACAGTGG - Intergenic
1148103235 17:45105378-45105400 CCCAGTGCCACAGGGGACATAGG + Intronic
1151969863 17:77452020-77452042 GCCGGCGCCGCGGGGAGCTTCGG - Intronic
1152119905 17:78412109-78412131 GCCAGGGCAGCTGGGAACAATGG - Intronic
1153796858 18:8631540-8631562 GCCAGTGCTGCTGAGAAAATTGG + Intronic
1154059405 18:11045611-11045633 GCCAGCTCAGCTGGGAACATGGG + Intronic
1157010582 18:43643877-43643899 GCCAGTGCAGCAGGGCCCATGGG - Intergenic
1163527686 19:17831180-17831202 GCCAGAGCCGTGGGGAATAGGGG + Intronic
1168703264 19:58453916-58453938 GCCAGGGCCACGTGGAACAAGGG + Intronic
930107587 2:47652249-47652271 TTCATTGCCGCAGGGAACATAGG - Intergenic
940009872 2:149041409-149041431 GCCAGTGACGCGGGGAACTTCGG - Intronic
947488166 2:230571370-230571392 GGCAGTGCAGAGGGGAATATGGG - Intergenic
948562964 2:238866175-238866197 GCCCGTGCCATGGGGAACCTGGG - Intronic
1170972206 20:21126292-21126314 GCCTGGGCCCCGGGGAACCTCGG - Intronic
1171394298 20:24821621-24821643 GCCAGTACCGTGGGGCCCATGGG - Intergenic
1175629234 20:60519275-60519297 GCCAGTGAGGTGGGGAAGATGGG - Intergenic
1180876730 22:19178336-19178358 GCCAGTGCCGCGGGGAACATAGG + Intronic
1182833721 22:33324443-33324465 GCCACTGCCACAGGGAACAGAGG + Intronic
959513598 3:107241025-107241047 ACCAGTGCCGCTGGGCACACTGG + Intergenic
961209843 3:125117219-125117241 GCCAGTGCCTGGGGCAACCTGGG - Intronic
968046302 3:195625475-195625497 GCCAGTGCATCAGGGAACACAGG - Intergenic
968232799 3:197014056-197014078 GCCAGTGCTGCGATAAACATGGG - Intronic
968308350 3:197664616-197664638 GCCAGTGCATCAGGGAACACAGG + Intergenic
968463332 4:736815-736837 GACAGTGTCGCGGGGAACCTGGG + Intronic
968901876 4:3435838-3435860 GCCAGTCCTGGAGGGAACATGGG - Intronic
969289801 4:6231240-6231262 GCCAGTCCCGGTGGGAGCATGGG - Intergenic
985747010 5:1653399-1653421 GCCAGTGCATCAGGGAACACAGG + Intergenic
986263809 5:6175200-6175222 GGCAGTGCCGCTGGGCACACAGG - Intergenic
995733012 5:115265485-115265507 GCCGGTGCAGCGGGGGACCTGGG - Intergenic
998146887 5:139734128-139734150 GCCTGTGCCACGGAGTACATGGG + Intergenic
1002575100 5:180169969-180169991 GCCAGTGCCGTGTGGAGCAGTGG - Intronic
1004752941 6:18582651-18582673 GCCAGTGACTCTGGGACCATGGG + Intergenic
1013463596 6:110398833-110398855 GCCAGTGCTGCGGTCAGCATAGG + Intronic
1019733253 7:2638736-2638758 GCCAGTGTCGCTGGGAGCCTGGG + Intronic
1023995903 7:45158659-45158681 GCCAGTTCTGGGGGGGACATTGG + Intronic
1024972038 7:55079311-55079333 GCCTGTGCAGCGGGGAAGAGGGG + Intronic
1025098466 7:56115967-56115989 ACCAGTGCCCCGGGGACCCTAGG - Intronic
1027174786 7:75896467-75896489 GCCAGTGCCAGGAGGACCATCGG + Intergenic
1029699459 7:102236839-102236861 GCCTGTGCCGAGGGAAAGATGGG - Intronic
1035312602 7:157979094-157979116 GCCAGGGCCGCGGGGGCGATGGG - Intronic
1036780520 8:11643816-11643838 CCCAGGGCTCCGGGGAACATGGG + Intergenic
1061231516 9:129318563-129318585 CCGAGTGCCCCAGGGAACATGGG - Intergenic
1062416593 9:136454258-136454280 GGCAGTGGCACTGGGAACATCGG + Exonic
1190318602 X:49166282-49166304 GCCAGGGCCCCGGGGAACCCGGG - Exonic
1202134969 Y:21651870-21651892 CCCAGTGCCTCTGGGAACAGTGG + Intergenic