ID: 1180876732

View in Genome Browser
Species Human (GRCh38)
Location 22:19178340-19178362
Sequence GTGCCGCGGGGAACATAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180876724_1180876732 8 Left 1180876724 22:19178309-19178331 CCGGACTTCGGTCGGCGCGGCCG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1180876732 22:19178340-19178362 GTGCCGCGGGGAACATAGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 55
1180876723_1180876732 9 Left 1180876723 22:19178308-19178330 CCCGGACTTCGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1180876732 22:19178340-19178362 GTGCCGCGGGGAACATAGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 55
1180876713_1180876732 21 Left 1180876713 22:19178296-19178318 CCCCTCCCCCGTCCCGGACTTCG 0: 1
1: 0
2: 0
3: 21
4: 204
Right 1180876732 22:19178340-19178362 GTGCCGCGGGGAACATAGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 55
1180876717_1180876732 16 Left 1180876717 22:19178301-19178323 CCCCCGTCCCGGACTTCGGTCGG 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1180876732 22:19178340-19178362 GTGCCGCGGGGAACATAGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 55
1180876719_1180876732 15 Left 1180876719 22:19178302-19178324 CCCCGTCCCGGACTTCGGTCGGC 0: 1
1: 0
2: 0
3: 4
4: 26
Right 1180876732 22:19178340-19178362 GTGCCGCGGGGAACATAGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 55
1180876716_1180876732 19 Left 1180876716 22:19178298-19178320 CCTCCCCCGTCCCGGACTTCGGT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1180876732 22:19178340-19178362 GTGCCGCGGGGAACATAGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 55
1180876714_1180876732 20 Left 1180876714 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1180876732 22:19178340-19178362 GTGCCGCGGGGAACATAGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 55
1180876720_1180876732 14 Left 1180876720 22:19178303-19178325 CCCGTCCCGGACTTCGGTCGGCG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1180876732 22:19178340-19178362 GTGCCGCGGGGAACATAGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 55
1180876721_1180876732 13 Left 1180876721 22:19178304-19178326 CCGTCCCGGACTTCGGTCGGCGC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1180876732 22:19178340-19178362 GTGCCGCGGGGAACATAGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180876732 Original CRISPR GTGCCGCGGGGAACATAGGC TGG Intronic
901160418 1:7172980-7173002 GTGCCTCGGGGAGGATGGGCTGG + Intronic
901827924 1:11874598-11874620 GAGGGGCTGGGAACATAGGCAGG + Intergenic
913253337 1:116930810-116930832 GGGCCACGGGGGACACAGGCAGG - Intronic
920242332 1:204562321-204562343 CTACCGCGGGGTACACAGGCGGG + Intergenic
1072198774 10:93140207-93140229 GTGGCGGGGGGAACAATGGCAGG - Intergenic
1083090438 11:60193825-60193847 GAGCCTCGGAGAACAAAGGCAGG - Intergenic
1084154190 11:67304456-67304478 GTGCTGCTGGGAACATGGTCGGG - Intronic
1084323379 11:68385758-68385780 GTGCCGGGGGGCTCCTAGGCAGG - Intronic
1084764348 11:71298394-71298416 GTGTCCCGGAGAACATCGGCAGG - Intergenic
1085327691 11:75619771-75619793 GTGCTGCGGTGAACATATACAGG + Intronic
1089385003 11:118061657-118061679 GGGCTGTGGGGAACATAAGCAGG - Intergenic
1101874746 12:108590723-108590745 GTGCCTCGGGGAACCTAGTTTGG + Exonic
1102082184 12:110107444-110107466 GTGCAGTGGGGAACAAAGCCAGG - Intergenic
1102197571 12:111035492-111035514 GTGCGGCGGGGATCAGGGGCGGG + Intronic
1102917527 12:116765588-116765610 GTGTCCCAGGGTACATAGGCAGG + Intronic
1112583317 13:100695093-100695115 GGGCAGCAGGGGACATAGGCTGG + Intergenic
1113913377 13:113855354-113855376 GTGCTGCTGTGAACAGAGGCCGG - Intronic
1119122051 14:72088766-72088788 ATGAGGAGGGGAACATAGGCAGG - Intronic
1124134996 15:27027447-27027469 GTGCAGCAGGGAGCACAGGCAGG - Intronic
1124172336 15:27387678-27387700 GTGCAGTGGGGATCACAGGCAGG + Intronic
1127994803 15:64147227-64147249 GCGCCACGGGGCACAGAGGCTGG - Intergenic
1133772719 16:8876997-8877019 GTGCTGCGGGGAACGTGGGCAGG + Intergenic
1136269182 16:29138486-29138508 TAGGCGCGGGGAACACAGGCCGG + Intergenic
1144758486 17:17694330-17694352 GTGCGGGGAGGAACATAGCCAGG + Intronic
1147583295 17:41638653-41638675 GTGCAGAGGGGAAGAAAGGCTGG - Intergenic
1152797475 17:82315278-82315300 GTGCTGGGGGGACCACAGGCGGG + Exonic
1158643262 18:59220651-59220673 GTGCCCTGGGGAAGACAGGCTGG - Intronic
1159241856 18:65751449-65751471 GTGCAGCGGCAAACATGGGCAGG + Intronic
1162848857 19:13415228-13415250 GTGCGGCGCGGAATAGAGGCAGG + Intronic
1163118879 19:15203990-15204012 GTGGCGGGGGGAACTGAGGCAGG - Intergenic
1165657779 19:37549162-37549184 GCGCCCCGGGGAACACAGGCAGG - Intergenic
933664520 2:84954219-84954241 GTGCCTAGGAGAACAAAGGCAGG + Intergenic
935077556 2:99760611-99760633 GTGAAGTGGGGAACACAGGCAGG - Intronic
936713868 2:115162286-115162308 GTGCCCCGGGGAACCCCGGCGGG + Intronic
943035784 2:182744391-182744413 GTGTAGCGGGGAACAGAGGAGGG + Intronic
1170683140 20:18544572-18544594 GTGCAGTGGGGAACAGAGTCAGG + Intronic
1175401752 20:58703992-58704014 CTGCAGCGGGGAAGATGGGCTGG - Intronic
1175996032 20:62812716-62812738 GGGCCACGGGGAAGATAGGCCGG + Exonic
1179715017 21:43282031-43282053 GTGTTGCGGGGAACTGAGGCCGG - Intergenic
1180876732 22:19178340-19178362 GTGCCGCGGGGAACATAGGCTGG + Intronic
1181299086 22:21867072-21867094 GTGGCGCGGGGGGCGTAGGCCGG - Intronic
1183466047 22:37980886-37980908 GTGGCACTGGGAACAGAGGCTGG + Intronic
1184864274 22:47193700-47193722 GTGCCTCGGGGACCCTAGGGAGG + Intergenic
964024740 3:152058628-152058650 GTGCTGCGATGAACATATGCGGG + Intergenic
974325115 4:60404320-60404342 CTGCCTTGGGCAACATAGGCAGG + Intergenic
992315158 5:75544913-75544935 GTGCCCAGGGGAATATAGGTTGG - Intronic
992690709 5:79237415-79237437 GTTCCTCGGGGAACACCGGCAGG - Exonic
995312209 5:110726638-110726660 GAGCCGCTGGGAACCAAGGCTGG + Exonic
1002081422 5:176739850-176739872 GTGCCGAGGTAAACACAGGCTGG - Intergenic
1003100969 6:3176298-3176320 GTGCTGTGGGGAACAGAGCCAGG + Intergenic
1017208440 6:151828794-151828816 GAGACTCTGGGAACATAGGCTGG - Intronic
1024972041 7:55079315-55079337 GTGCAGCGGGGAAGAGGGGCGGG + Intronic
1025810582 7:64872913-64872935 CAGCCCCGGGGAACACAGGCAGG - Intronic
1033977152 7:147116475-147116497 GTCCCGTGGAGAACACAGGCAGG + Intronic
1034938875 7:155217406-155217428 GAGCAGCTGGGACCATAGGCAGG - Intergenic
1039803773 8:40981916-40981938 GTGAGGCGGGGAACAAAGGCAGG + Intergenic
1057014912 9:91642853-91642875 CTGCCCCGGAGAACATGGGCAGG - Intronic
1060869438 9:127028101-127028123 GTGCCTCTGGCAACACAGGCAGG - Intronic
1188294466 X:28430779-28430801 GTGCTGCAATGAACATAGGCAGG + Intergenic
1189751223 X:44224975-44224997 ATGCAGTTGGGAACATAGGCAGG - Intronic