ID: 1180876733

View in Genome Browser
Species Human (GRCh38)
Location 22:19178341-19178363
Sequence TGCCGCGGGGAACATAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180876719_1180876733 16 Left 1180876719 22:19178302-19178324 CCCCGTCCCGGACTTCGGTCGGC 0: 1
1: 0
2: 0
3: 4
4: 26
Right 1180876733 22:19178341-19178363 TGCCGCGGGGAACATAGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1180876720_1180876733 15 Left 1180876720 22:19178303-19178325 CCCGTCCCGGACTTCGGTCGGCG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1180876733 22:19178341-19178363 TGCCGCGGGGAACATAGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1180876723_1180876733 10 Left 1180876723 22:19178308-19178330 CCCGGACTTCGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1180876733 22:19178341-19178363 TGCCGCGGGGAACATAGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1180876721_1180876733 14 Left 1180876721 22:19178304-19178326 CCGTCCCGGACTTCGGTCGGCGC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1180876733 22:19178341-19178363 TGCCGCGGGGAACATAGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1180876717_1180876733 17 Left 1180876717 22:19178301-19178323 CCCCCGTCCCGGACTTCGGTCGG 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1180876733 22:19178341-19178363 TGCCGCGGGGAACATAGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1180876716_1180876733 20 Left 1180876716 22:19178298-19178320 CCTCCCCCGTCCCGGACTTCGGT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1180876733 22:19178341-19178363 TGCCGCGGGGAACATAGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1180876713_1180876733 22 Left 1180876713 22:19178296-19178318 CCCCTCCCCCGTCCCGGACTTCG 0: 1
1: 0
2: 0
3: 21
4: 204
Right 1180876733 22:19178341-19178363 TGCCGCGGGGAACATAGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1180876714_1180876733 21 Left 1180876714 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1180876733 22:19178341-19178363 TGCCGCGGGGAACATAGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1180876724_1180876733 9 Left 1180876724 22:19178309-19178331 CCGGACTTCGGTCGGCGCGGCCG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1180876733 22:19178341-19178363 TGCCGCGGGGAACATAGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180876733 Original CRISPR TGCCGCGGGGAACATAGGCT GGG Intronic
903656087 1:24949698-24949720 GGCCGCGTGGATGATAGGCTGGG - Intronic
903813441 1:26047128-26047150 TGTCGCTAGGACCATAGGCTTGG + Intergenic
913536296 1:119775648-119775670 TGCCTGGAGGGACATAGGCTGGG + Intergenic
916445057 1:164864399-164864421 TTCCGTGGGCAACAGAGGCTGGG - Intronic
917116140 1:171605650-171605672 TTCCGCGGGAAGCATAGACTGGG - Intergenic
1068022751 10:51605088-51605110 TGCCGAGGGGAGTATAGCCTTGG - Intronic
1069024236 10:63522049-63522071 AGCCGCGGGATACAAAGGCTCGG - Intronic
1075626741 10:123969348-123969370 TGCCCTGGGGAAGATGGGCTGGG - Intergenic
1083656005 11:64230116-64230138 TGCAGAGGGGGACACAGGCTGGG - Intronic
1091760641 12:3085039-3085061 TGCCGCTAGGCACATGGGCTTGG + Intronic
1101874747 12:108590724-108590746 TGCCTCGGGGAACCTAGTTTGGG + Exonic
1103952827 12:124560727-124560749 TGCCTCGGGGAACAGAAACTGGG + Intronic
1112583318 13:100695094-100695116 GGCAGCAGGGGACATAGGCTGGG + Intergenic
1114532529 14:23404687-23404709 TGCCATGGGGGACACAGGCTCGG - Intronic
1119122050 14:72088765-72088787 TGAGGAGGGGAACATAGGCAGGG - Intronic
1121329677 14:93041957-93041979 CACCGCGGGGGACACAGGCTGGG - Intronic
1123115748 14:105893303-105893325 TGCCGCGGCTAAGATAGGGTGGG - Intergenic
1123119991 14:105912018-105912040 TGCCGCGGCTAAGATAGGGTGGG - Intergenic
1125456429 15:39864414-39864436 TGCCGCTGGGAAAATTGGATTGG + Intronic
1135894126 16:26383075-26383097 TGCCAGGGGGAACAGAGGCCTGG + Intergenic
1139420102 16:66844682-66844704 TGGCGCGGGGGACCAAGGCTTGG - Intronic
1141661412 16:85443639-85443661 TGCAGCGGGGAACCGAGGCCTGG + Intergenic
1147583294 17:41638652-41638674 TGCAGAGGGGAAGAAAGGCTGGG - Intergenic
1147862738 17:43533181-43533203 TACCTCGGGGAACATAGGTAAGG - Exonic
1148564573 17:48625504-48625526 TCCTGCGGGGAACAGGGGCTCGG - Intronic
1150248765 17:63694641-63694663 TCCAGTGGGGAACAAAGGCTGGG - Exonic
1151421307 17:73999894-73999916 TTCCGCAGGGAACATCAGCTAGG + Intergenic
1157491046 18:48124071-48124093 TGACCTGGGGATCATAGGCTGGG + Intronic
1157594172 18:48853774-48853796 TGCTGCGGGGCCCCTAGGCTGGG + Intronic
1159917137 18:74197957-74197979 AGCCCAGGGGAACCTAGGCTCGG + Intergenic
1160017882 18:75158130-75158152 TGCAGCGGGGAAGGCAGGCTTGG - Intergenic
1161518498 19:4710471-4710493 TGCTGCTGGGAAGATGGGCTGGG - Intronic
1167148183 19:47694855-47694877 AGGGGTGGGGAACATAGGCTAGG - Intronic
943731109 2:191304894-191304916 TGCCGGTGTGAACATAGGCTTGG - Intronic
946419853 2:219558474-219558496 TGGAGAGGGGCACATAGGCTTGG + Intronic
1175923208 20:62459452-62459474 TGCCACGGGGAGCCTGGGCTGGG + Intergenic
1176389375 21:6155781-6155803 TGCCGAGGAGAACACAGGCTAGG - Intergenic
1179734094 21:43382457-43382479 TGCCGAGGAGAACACAGGCTAGG + Intergenic
1180876733 22:19178341-19178363 TGCCGCGGGGAACATAGGCTGGG + Intronic
1183466048 22:37980887-37980909 TGGCACTGGGAACAGAGGCTGGG + Intronic
1183525098 22:38317886-38317908 TGCCGCAGAGAACACAGGCCAGG + Intronic
950169529 3:10828528-10828550 TGCAGAGGGGAAGATAGGCCTGG - Intronic
954201010 3:49022998-49023020 TGCTGCGGGGAGCACAGGCCTGG + Intronic
960007580 3:112795892-112795914 TGCCAGGGGCAACATGGGCTAGG + Intronic
973203215 4:47529358-47529380 TGGCGCTGGGAAAATTGGCTAGG - Intronic
974325116 4:60404321-60404343 TGCCTTGGGCAACATAGGCAGGG + Intergenic
991159873 5:63485734-63485756 TCCTGCCTGGAACATAGGCTGGG + Intergenic
1002081421 5:176739849-176739871 TGCCGAGGTAAACACAGGCTGGG - Intergenic
1006295300 6:33167491-33167513 TGCCCCGGGGAAGACAGGCCCGG - Exonic
1007966921 6:46011896-46011918 TGCCTTGGGGAACAAAGGCCTGG - Intronic
1008510603 6:52272273-52272295 TGCCTGGGGGAGCCTAGGCTTGG - Intronic
1016773765 6:147881372-147881394 TGCCGCGGGGAACCTTGACGCGG - Intergenic
1017208439 6:151828793-151828815 AGACTCTGGGAACATAGGCTGGG - Intronic
1027208519 7:76124128-76124150 TGCCGAGAGAAACAAAGGCTGGG - Intergenic
1036239679 8:7071345-7071367 TGACACGGGGAACACAGCCTGGG + Intergenic
1039803774 8:40981917-40981939 TGAGGCGGGGAACAAAGGCAGGG + Intergenic
1049667662 8:143853842-143853864 TGCCGCGGGGAGCATCGGGCTGG - Intergenic
1056823562 9:89861108-89861130 TACCTTGGGGAGCATAGGCTTGG + Intergenic
1061039394 9:128131174-128131196 TACCTTGGGGAGCATAGGCTTGG - Intergenic
1189751222 X:44224974-44224996 TGCAGTTGGGAACATAGGCAGGG - Intronic