ID: 1180876734

View in Genome Browser
Species Human (GRCh38)
Location 22:19178342-19178364
Sequence GCCGCGGGGAACATAGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 75}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180876723_1180876734 11 Left 1180876723 22:19178308-19178330 CCCGGACTTCGGTCGGCGCGGCC 0: 1
1: 0
2: 0
3: 6
4: 35
Right 1180876734 22:19178342-19178364 GCCGCGGGGAACATAGGCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 75
1180876720_1180876734 16 Left 1180876720 22:19178303-19178325 CCCGTCCCGGACTTCGGTCGGCG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1180876734 22:19178342-19178364 GCCGCGGGGAACATAGGCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 75
1180876714_1180876734 22 Left 1180876714 22:19178297-19178319 CCCTCCCCCGTCCCGGACTTCGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1180876734 22:19178342-19178364 GCCGCGGGGAACATAGGCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 75
1180876724_1180876734 10 Left 1180876724 22:19178309-19178331 CCGGACTTCGGTCGGCGCGGCCG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1180876734 22:19178342-19178364 GCCGCGGGGAACATAGGCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 75
1180876721_1180876734 15 Left 1180876721 22:19178304-19178326 CCGTCCCGGACTTCGGTCGGCGC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1180876734 22:19178342-19178364 GCCGCGGGGAACATAGGCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 75
1180876717_1180876734 18 Left 1180876717 22:19178301-19178323 CCCCCGTCCCGGACTTCGGTCGG 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1180876734 22:19178342-19178364 GCCGCGGGGAACATAGGCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 75
1180876716_1180876734 21 Left 1180876716 22:19178298-19178320 CCTCCCCCGTCCCGGACTTCGGT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1180876734 22:19178342-19178364 GCCGCGGGGAACATAGGCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 75
1180876719_1180876734 17 Left 1180876719 22:19178302-19178324 CCCCGTCCCGGACTTCGGTCGGC 0: 1
1: 0
2: 0
3: 4
4: 26
Right 1180876734 22:19178342-19178364 GCCGCGGGGAACATAGGCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 75
1180876728_1180876734 -10 Left 1180876728 22:19178329-19178351 CCGCCGCGCCAGTGCCGCGGGGA 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1180876734 22:19178342-19178364 GCCGCGGGGAACATAGGCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 75
1180876713_1180876734 23 Left 1180876713 22:19178296-19178318 CCCCTCCCCCGTCCCGGACTTCG 0: 1
1: 0
2: 0
3: 21
4: 204
Right 1180876734 22:19178342-19178364 GCCGCGGGGAACATAGGCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180876734 Original CRISPR GCCGCGGGGAACATAGGCTG GGG Intronic
900491681 1:2952422-2952444 GCCCCAGGGAAGCTAGGCTGGGG + Intergenic
900665712 1:3814229-3814251 GCCCCTGGGAGCACAGGCTGGGG + Exonic
913565473 1:120069113-120069135 GCCGCGGGGAGCAGAGGCGGCGG + Intronic
913632659 1:120724449-120724471 GCCGCGGGGAGCAGAGGCGGCGG - Intergenic
914286062 1:146228468-146228490 GCCGCGGGGAGCAGAGGCGGCGG + Intronic
914547093 1:148679221-148679243 GCCGCGGGGAGCAGAGGCGGCGG + Intronic
914619414 1:149391141-149391163 GCCGCGGGGAGCAGAGGCGGCGG - Intergenic
916445056 1:164864398-164864420 TCCGTGGGCAACAGAGGCTGGGG - Intronic
916802108 1:168225670-168225692 GCAGACGGGAACAAAGGCTGTGG - Intergenic
1064695265 10:17958541-17958563 GCCATGGAGAACACAGGCTGTGG - Intronic
1075520994 10:123143402-123143424 GAGGTGGGGAGCATAGGCTGAGG + Intergenic
1076724248 10:132405965-132405987 GCCGTGGGGGACATCGTCTGGGG + Exonic
1076889530 10:133276922-133276944 GCCGAGGGGCCCATTGGCTGCGG - Intergenic
1077148672 11:1058007-1058029 GCTGCGGCGAACATGGGGTGCGG + Intergenic
1083570995 11:63762454-63762476 GCCACGGGGAAAAGAGGCCGAGG + Exonic
1083885864 11:65573265-65573287 GGTGCGGGGAAGATGGGCTGGGG + Intronic
1083989907 11:66240550-66240572 GCCCCGAGGAGCAGAGGCTGAGG - Intronic
1085514622 11:77105130-77105152 GCCCCGGGACAGATAGGCTGGGG - Intronic
1088689221 11:112311093-112311115 GCCGAGGGGAGCCTGGGCTGGGG + Intergenic
1089361484 11:117890850-117890872 AACGCTGGGAACAGAGGCTGAGG - Intergenic
1091474013 12:753872-753894 GCCGCGGGGATGCTGGGCTGGGG - Exonic
1097283858 12:57862911-57862933 GCCGCAGGTTACATAGCCTGTGG + Intergenic
1103058984 12:117843613-117843635 GCAATGGGGAACAGAGGCTGGGG + Intronic
1103775795 12:123365261-123365283 GCCGCGGGGAAAAAAGGGCGGGG - Intergenic
1104299380 12:127550466-127550488 GCCACGGGGACCACATGCTGTGG + Intergenic
1106322214 13:28652009-28652031 GCCGAGAGGAACATACACTGTGG - Intergenic
1112583319 13:100695095-100695117 GCAGCAGGGGACATAGGCTGGGG + Intergenic
1119122049 14:72088764-72088786 GAGGAGGGGAACATAGGCAGGGG - Intronic
1122437697 14:101711100-101711122 GCCCCGGGGAACATGGTCTGTGG - Intergenic
1129518750 15:76172512-76172534 GCAGGGTGGAACATAGGGTGAGG - Intronic
1135143336 16:19940232-19940254 ACCCTGGGGAACACAGGCTGCGG + Intergenic
1143783095 17:9239739-9239761 GCCGCGGTGACCAGAGCCTGTGG + Exonic
1148123974 17:45227552-45227574 GCAGCAGGGAAAGTAGGCTGAGG + Intronic
1152314683 17:79573273-79573295 GCCACGGGGAACAAAGGCAGAGG + Intergenic
1159586812 18:70289472-70289494 GCTGCGGGCAACAAAGGCGGCGG - Intronic
1161028522 19:2047556-2047578 GTCGCGGGGATCAAAGGCAGCGG + Intronic
1161518497 19:4710470-4710492 GCTGCTGGGAAGATGGGCTGGGG - Intronic
1161912981 19:7208333-7208355 GCCAGAGGGAAGATAGGCTGAGG - Intronic
1162584691 19:11551743-11551765 GGCGCGGGGAAGCTATGCTGAGG + Intronic
1162654183 19:12116478-12116500 GCAGAGGGTAACAGAGGCTGAGG + Intronic
1164258681 19:23550944-23550966 GGGTCGGGGAACAGAGGCTGAGG - Intronic
1164704552 19:30310862-30310884 GCCACAGGGACCATGGGCTGTGG + Intronic
1164912289 19:32022759-32022781 GCCGTGGGAAACAGAGGCTTAGG - Intergenic
1165336249 19:35171872-35171894 GCAGTGGGGGACATAGGTTGTGG + Intergenic
1168199417 19:54804181-54804203 GCCATGGGGAAGAAAGGCTGGGG - Intronic
925582133 2:5421720-5421742 GGGGCCGGGAACAGAGGCTGAGG + Intergenic
926363043 2:12108045-12108067 GCCAGGGGGAAAAGAGGCTGTGG - Intergenic
929242387 2:39666013-39666035 GCCCCAGGGAGCACAGGCTGAGG - Exonic
944120969 2:196240407-196240429 GGCCTGTGGAACATAGGCTGTGG - Intronic
947918170 2:233848171-233848193 GCAGAGGGGGACAGAGGCTGCGG + Intronic
1175326449 20:58132061-58132083 GCCCTGGGGAACACAGGATGTGG - Intergenic
1175923209 20:62459453-62459475 GCCACGGGGAGCCTGGGCTGGGG + Intergenic
1176010053 20:62888423-62888445 GCCGCAGAGAACTGAGGCTGTGG + Intronic
1176060991 20:63172936-63172958 GCCGCTGAGAACATAGGGGGAGG + Intergenic
1178326838 21:31653469-31653491 GCCACAGGCACCATAGGCTGCGG - Intergenic
1179989590 21:44940175-44940197 GCCGCGGGGAAGGTGAGCTGGGG + Exonic
1180876734 22:19178342-19178364 GCCGCGGGGAACATAGGCTGGGG + Intronic
1182294991 22:29307230-29307252 GCCCCGGGGAACAGAGGCCGAGG - Intronic
1184275341 22:43406580-43406602 GCCGAGGGGCACACGGGCTGAGG - Intergenic
950115729 3:10449414-10449436 GCTGCGGGGCACTGAGGCTGTGG - Exonic
950749633 3:15118654-15118676 GCGGCTGGGAGCATAGGCTCAGG - Intergenic
950785118 3:15427808-15427830 ACCGCGAGGAACATTGCCTGAGG + Exonic
953229928 3:41055530-41055552 GCTGAGGGAAACATAGGCTGTGG - Intergenic
960112254 3:113856471-113856493 GCCGGGGGTAACATAGGGGGTGG - Intronic
991159875 5:63485735-63485757 CCTGCCTGGAACATAGGCTGGGG + Intergenic
996903207 5:128567574-128567596 GACTGGGGGAACAAAGGCTGAGG + Intronic
1002926687 6:1609425-1609447 GCGGCGGGGAGGAGAGGCTGGGG + Intergenic
1005256840 6:24012326-24012348 GATGCTGGGAACACAGGCTGAGG - Intergenic
1019428526 7:988223-988245 GCCCCGGGGAAGATGGGATGGGG - Intronic
1023959251 7:44912984-44913006 GCCTCGGGGGACATAGGCCCTGG + Intergenic
1025232931 7:57214807-57214829 GCCCCAGGGAACATTGGCTCTGG + Intergenic
1025723404 7:64036740-64036762 GCAGTGGGTAACATGGGCTGTGG - Intronic
1025752548 7:64306380-64306402 GCAGTGGGTAACATGGGCTGTGG - Intergenic
1027267997 7:76504529-76504551 GCAGCGGAGGACAGAGGCTGAGG + Intronic
1027319808 7:77004391-77004413 GCAGCGGAGGACAGAGGCTGAGG + Intergenic
1028741116 7:94276977-94276999 GCCTTGGGGAACAAAGGATGTGG + Intergenic
1029264290 7:99326101-99326123 GCCGCGGGGCCCCGAGGCTGAGG + Intronic
1035562494 8:616656-616678 GGCGCGGGGGACAGAGGCAGAGG + Intronic
1036225811 8:6956488-6956510 GCCGTGGTTAACACAGGCTGTGG - Intergenic
1049471740 8:142777777-142777799 GACGCGGTGAAGATAGCCTGCGG - Exonic
1055397562 9:75891170-75891192 GGCGCCGGGACCATGGGCTGGGG + Exonic
1061839245 9:133348038-133348060 GCGGCGGGGAAGAGAGACTGCGG - Intronic
1187245298 X:17548424-17548446 TCCCCAGGGAACAGAGGCTGGGG + Intronic
1195971806 X:110481360-110481382 GCAGTGGGGAAGTTAGGCTGAGG + Intergenic
1199541226 X:148959923-148959945 GCAGTGGGGACCAAAGGCTGTGG - Intronic
1200109675 X:153733941-153733963 GCCTCAGGGATCATTGGCTGGGG - Intronic