ID: 1180880023

View in Genome Browser
Species Human (GRCh38)
Location 22:19197105-19197127
Sequence GAGAGTGTCAGAGGCGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180880023_1180880030 0 Left 1180880023 22:19197105-19197127 CCCCACACGCCTCTGACACTCTC 0: 1
1: 0
2: 2
3: 14
4: 227
Right 1180880030 22:19197128-19197150 CCTGGACAAGACCAGACGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180880023 Original CRISPR GAGAGTGTCAGAGGCGTGTG GGG (reversed) Intronic
900649415 1:3723685-3723707 GAGAGTGCCCGAGGCGGATGTGG - Intronic
902347540 1:15829436-15829458 CAAAGAGTCAGAGGAGTGTGTGG - Intergenic
903293660 1:22330239-22330261 GAGAGGGCCAGAGGGGTCTGTGG - Intergenic
904501493 1:30915317-30915339 GAGAGTGACCGGGGCCTGTGGGG + Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
906208715 1:44000594-44000616 GAGAGAGTCAGAGAGGCGTGTGG - Intronic
906514507 1:46431096-46431118 GAGAGTGTCAGACGCTGCTGAGG + Intergenic
906615754 1:47231953-47231975 GAGAGTCTCCGAGGCGGGAGGGG + Intronic
908455085 1:64296205-64296227 CAGAATGTCAGAGGAGTGAGGGG - Intergenic
910160963 1:84271722-84271744 GAGAGTAGGAGAGGCGTGAGCGG + Intergenic
910549267 1:88457461-88457483 GTGTGTGTGTGAGGCGTGTGTGG - Intergenic
910672853 1:89790353-89790375 GATAGTCTCAGAGGTGCGTGAGG + Intronic
912218931 1:107649971-107649993 GAGAGTGACAGGGGTGTGTGTGG + Intronic
912370264 1:109168232-109168254 GAGAGTGTAACAGGAGTCTGTGG - Intronic
914804256 1:150981323-150981345 GAGAGAGGCAGAGGAGTGAGTGG + Intergenic
915110800 1:153563711-153563733 GTGAGTGGCACAGGCCTGTGGGG - Intronic
915660403 1:157400583-157400605 GTGAGTGTCAGGGGAGGGTGTGG + Intergenic
916667079 1:166975890-166975912 GAGAGTGACAGCGGCGAGGGTGG + Intronic
916911655 1:169355504-169355526 GAGGGTGGCAGAGGCAGGTGAGG - Intronic
918238251 1:182600328-182600350 CAGAGTGGCAGAGGCGGCTGAGG + Exonic
921805295 1:219447031-219447053 GAGAGAGACAGGGGCGGGTGGGG - Intergenic
922043835 1:221924241-221924263 GAGAGTGTTAGGGGCTCGTGAGG + Intergenic
922233207 1:223703931-223703953 GAGAGGGTCTGTGGCATGTGTGG - Intronic
923944838 1:238873008-238873030 GAGGGTGGAAGAGGAGTGTGGGG - Intergenic
924732833 1:246727778-246727800 GAGTGTGACAGAGGCCAGTGTGG + Intronic
1062809750 10:453971-453993 AAGTGTGACAGAGGCATGTGAGG - Intronic
1064432738 10:15285266-15285288 GAGAGCGTGAGAGGCGTAGGAGG + Intronic
1065802529 10:29366037-29366059 GAGAGTGAGAGAGGGCTGTGAGG - Intergenic
1069597461 10:69681639-69681661 GAGAGTGTCAGTAGAGGGTGGGG + Intergenic
1070786820 10:79166779-79166801 GAGGGTCTCAGTGGCCTGTGAGG + Intronic
1071723106 10:88167148-88167170 AAGACTGTCAGAGGCCTGAGAGG - Intergenic
1075372601 10:121950506-121950528 GAGAGTGTAGGAGGTATGTGGGG + Intergenic
1077074553 11:694485-694507 GAAAGTGTGAGGGGCGGGTGGGG + Intronic
1077283153 11:1754481-1754503 GAGAGTCACAGAGGGATGTGGGG + Intronic
1081241886 11:40716813-40716835 GAGAGTGACAGATGCTGGTGGGG + Intronic
1081725788 11:45328206-45328228 GAGAGTCTCAGAAGCTGGTGTGG + Intergenic
1082935626 11:58653807-58653829 GAGAGAGACAGAAGAGTGTGGGG - Intronic
1082940740 11:58703087-58703109 CAGATTGTCAGAGGGGTTTGGGG - Intronic
1084666842 11:70580921-70580943 CAGAGTGACAGAGGAGTGTGGGG - Intronic
1085206059 11:74732560-74732582 AAGAGTGCCAGAGGAGTATGAGG + Intergenic
1087568814 11:99896911-99896933 GGGAATATCAGAGGCCTGTGGGG - Intronic
1089270637 11:117299537-117299559 GAGATTGTCAGAGGAGTCTTTGG - Intronic
1091334871 11:134758781-134758803 GACAGTTGCAGAGGGGTGTGTGG + Intergenic
1091559969 12:1604800-1604822 GAGAGTGTGTGGGGTGTGTGTGG + Intronic
1091704825 12:2686575-2686597 GCCAGTGTCAGAGGCGTCAGTGG - Intronic
1091744316 12:2981528-2981550 TGGAGTGTCAGAGGCTTGGGTGG - Intronic
1092834285 12:12472918-12472940 GAGAGTGAGTGAGGGGTGTGAGG + Intergenic
1092974035 12:13726807-13726829 GAAAGGGTCGGAGGCGGGTGAGG - Intronic
1093881950 12:24414831-24414853 GAGAGTTTCATAGGCATGTGGGG - Intergenic
1096488032 12:51996720-51996742 AAGAGTGGCAGAGGTGGGTGTGG - Intronic
1096882593 12:54684903-54684925 AAGAGTGTATGAGGGGTGTGAGG + Intergenic
1098476666 12:70911896-70911918 GAGAGTGTCATAGAAGTGTTAGG - Intronic
1099518622 12:83630383-83630405 CAGGGGGTCAGAGGGGTGTGAGG + Intergenic
1102096614 12:110246314-110246336 GAGGGTGTCAAAGGCCTGTAAGG - Intergenic
1104830877 12:131750422-131750444 GAGAGAATCACAGGTGTGTGTGG + Intronic
1104934804 12:132358710-132358732 GAGACTCTCAGAGGCGGCTGTGG - Intergenic
1106402661 13:29444755-29444777 GAGAGTGGCACAGGTGGGTGGGG + Intronic
1106529514 13:30576658-30576680 GAGAGAGGCAGCGACGTGTGTGG - Intronic
1108695983 13:52902736-52902758 GAGAGTATCAGAGGAATGGGAGG + Intergenic
1110289908 13:73793236-73793258 GAGATGGTCAGATGTGTGTGCGG + Intronic
1113281734 13:108796007-108796029 TACAGTGTCAGGGGCGAGTGTGG + Intronic
1113719819 13:112546712-112546734 GAAAGTGACAGAGGAGTTTGGGG + Intronic
1113894762 13:113756863-113756885 CAGGGTGCCAGAGGCTTGTGGGG - Intergenic
1118712518 14:68533924-68533946 GAGAGGGGCAAAGGCGTGTAAGG + Intronic
1119192091 14:72689732-72689754 GAGCAAGTCAGCGGCGTGTGTGG + Intronic
1120313399 14:82860372-82860394 CAGAGTGTCAGAGTCTTGGGAGG - Intergenic
1120686834 14:87547833-87547855 GAGAGTGTCAGAGACCAGTAGGG + Intergenic
1121529777 14:94644208-94644230 GAGAGTGACAGAGCCCTGAGGGG - Intergenic
1121826497 14:97014074-97014096 GAGGGTGCCAGATGTGTGTGTGG + Intergenic
1123070813 14:105641685-105641707 GACAGTGTCAGGGACATGTGGGG + Intergenic
1123095738 14:105766237-105766259 GACAGTGTCAGAGACAGGTGAGG + Intergenic
1123095803 14:105766510-105766532 GAGAGTGTCAGGGGCAGGTGGGG + Intergenic
1125588604 15:40840114-40840136 GAGAGTGTCAGAGCTGTCAGAGG - Intergenic
1127207566 15:56736028-56736050 GAGAGCGTGAGAGGGGAGTGAGG + Intronic
1127617058 15:60696571-60696593 TAGACTGTCAAAGGCGTATGTGG - Intronic
1128028773 15:64461145-64461167 GAGAGTTTCTGAGGCGAGTCTGG + Intronic
1129419411 15:75411634-75411656 GAGATTGTCACTGGTGTGTGAGG + Exonic
1131502736 15:92985610-92985632 GAGGGCGTCCGAGGAGTGTGCGG + Exonic
1134820579 16:17243793-17243815 GAGAAAGTCAGAGGGGTGAGGGG + Intronic
1135905903 16:26511559-26511581 GACCATGTCAGAGGCTTGTGTGG + Intergenic
1138920606 16:61523856-61523878 GAGAGAGTGAGAGGGGTGTGTGG - Intergenic
1139304459 16:65972004-65972026 GAAAGGGTGAGAGGGGTGTGAGG + Intergenic
1140692614 16:77498825-77498847 GAGAGAGTCAGAGGCGGGGGAGG + Intergenic
1141160540 16:81626577-81626599 GAGTGTGTGAGTGGTGTGTGGGG + Intronic
1141167276 16:81669053-81669075 GTGAGTGTGAGAGGTGGGTGTGG - Intronic
1141167286 16:81669101-81669123 GTGAGTGTGAGAGGTGGGTGTGG - Intronic
1141167316 16:81669239-81669261 GTGAGTGTGAGAGGTGGGTGTGG - Intronic
1141167326 16:81669287-81669309 GTGAGTGTGAGAGGTGGGTGTGG - Intronic
1141167348 16:81669378-81669400 GTGAGTGTGAGAGGTGGGTGTGG - Intronic
1141167379 16:81669515-81669537 GTGAGTGTGAGAGGTGGGTGTGG - Intronic
1141733386 16:85836831-85836853 GAGAGTTTGAGAGGTGTGTCTGG + Intergenic
1142430201 16:90022319-90022341 GAAAGTTTCAGAGGCTTGGGTGG + Intronic
1143333468 17:6155383-6155405 GAGAGCCTCAGAGGGGTGGGTGG - Intergenic
1143736683 17:8916220-8916242 GAGCGTGTCAAAGGGGTGGGTGG - Intronic
1143843932 17:9757664-9757686 GAGAGTGCCTGAGGCGTATTGGG + Intergenic
1144213569 17:13035138-13035160 GAGAGAGGCAGAGTCATGTGGGG + Intergenic
1144329682 17:14212516-14212538 GAGAGTGTCACAGGCGAGGTTGG - Intergenic
1146366728 17:32234595-32234617 GAGAGTGGGAGAGGCATGGGTGG + Intronic
1148782130 17:50128459-50128481 GAGAGTGTGCGGGGTGTGTGTGG - Intronic
1148985035 17:51613495-51613517 GAGAGGGGCAGAGGGGGGTGAGG - Intergenic
1150168567 17:62966925-62966947 GCGGGCTTCAGAGGCGTGTGGGG + Intergenic
1150888245 17:69112658-69112680 GAGAGAGTCAGAGGGGGATGGGG + Intronic
1150987079 17:70210942-70210964 GAGTGTGTCAGAGGCAAATGGGG - Intergenic
1151422155 17:74005602-74005624 GAGAGTTTGAGAGAAGTGTGTGG - Intergenic
1151587526 17:75019291-75019313 GAGAGTGTGGGAGGCTGGTGAGG - Intronic
1151734358 17:75929764-75929786 GAGAGTGCCACAGGCCTCTGGGG - Intronic
1153647995 18:7212257-7212279 GGGAGTGTCCCAGGCATGTGAGG + Intergenic
1154194690 18:12257055-12257077 GACAGTGTCAGAGGATGGTGGGG - Intronic
1157257667 18:46153093-46153115 GAGCGTGTCAGCTGTGTGTGAGG - Intergenic
1157494838 18:48149343-48149365 GAGGGTGTCAGAGCCCTGTTTGG - Intronic
1160167850 18:76529706-76529728 GAGAACGGCAGACGCGTGTGTGG + Intergenic
1160902063 19:1433631-1433653 GAGACTGGCAGGGGGGTGTGAGG + Intronic
1161278838 19:3434249-3434271 GAGGGTGACAGAGGAGAGTGAGG - Intronic
1163496283 19:17648178-17648200 GAGGGTGTCAGAGAGGGGTGGGG - Intronic
1164513876 19:28918032-28918054 GCGAGTGAGAGAAGCGTGTGGGG + Intergenic
1165802644 19:38562393-38562415 GGGTGTGTCAGGGGCGTGTGGGG - Intronic
1166297914 19:41897640-41897662 GAGAGAGTCAGAGGAGTGGTGGG - Intronic
1166713150 19:44949948-44949970 GAGACTGTCAGAGGCCACTGTGG - Intergenic
1166836003 19:45668344-45668366 GAGAGTGCCAGAGACTTGAGAGG - Intronic
1167649964 19:50723769-50723791 GATAGTCTCAGAGGAGTGGGAGG + Intronic
925862503 2:8193727-8193749 GAGAGAGTCAGAGGTGCTTGGGG - Intergenic
926008300 2:9389605-9389627 GACAGGGGCAGAGCCGTGTGAGG - Intronic
926188499 2:10709709-10709731 GAGGGTGTCAAAGGCATCTGTGG - Intergenic
927146581 2:20170098-20170120 GAGATAGACAGAGGAGTGTGAGG - Intergenic
928713187 2:34030475-34030497 GAGAGTGTCATAGATGTTTGCGG - Intergenic
929117971 2:38460438-38460460 GAGAGTGGCAGAGGTGTGTTTGG - Intergenic
929352567 2:40976087-40976109 GAGAGAATAAGAGGGGTGTGGGG - Intergenic
929411101 2:41698078-41698100 GAGAGAGACAGAGGAGTGTTTGG - Intergenic
929591764 2:43152548-43152570 GGGAGTGTCAGAGGCAGGGGAGG + Intergenic
933085379 2:78048409-78048431 GAAAGGGTGAGAGGCGGGTGAGG - Intergenic
935373845 2:102375406-102375428 GAGGGTGTCAAAGGTGTGGGTGG + Intronic
935720513 2:105975053-105975075 GAGAGAGTCAGAGAGGTGTTGGG - Intergenic
937347756 2:121137182-121137204 GAGAATGCCAGAGGCTTGGGAGG - Intergenic
937650247 2:124311438-124311460 GAGAGGGAGAGAGGAGTGTGGGG + Intronic
939211677 2:139183596-139183618 GAGAGAGGGAGAGGCATGTGGGG - Intergenic
946044319 2:216808883-216808905 GAGAGTGTGAGATGTGTGAGCGG - Intergenic
1168980453 20:1999056-1999078 GAGACTGACAGAGGTGGGTGAGG - Intergenic
1170968980 20:21101470-21101492 GAGAGTGACAGAGGCGCGTGCGG + Intergenic
1174568123 20:51481598-51481620 GGGAGTGTCTGTGGCGTCTGCGG + Intronic
1175213624 20:57377527-57377549 GAGTGAGCCAGAGGCGTGTGCGG - Intronic
1175502701 20:59461571-59461593 TAGGCTGTCAGATGCGTGTGGGG - Intergenic
1175970683 20:62685219-62685241 GAGGGTGGCAGCGGGGTGTGGGG + Intronic
1177515008 21:22138193-22138215 GGGAGTGTCAGAGAGGTATGTGG + Intergenic
1177650949 21:23961665-23961687 GAGAGAGTGAGAGGGGGGTGGGG - Intergenic
1178980244 21:37257753-37257775 GAGGGTACCAGAGGCGTGGGAGG + Intronic
1179163154 21:38914456-38914478 GAGAGAGAGAGAGGGGTGTGTGG - Intergenic
1179890078 21:44330924-44330946 GAGGGAGACAAAGGCGTGTGAGG + Intronic
1180880023 22:19197105-19197127 GAGAGTGTCAGAGGCGTGTGGGG - Intronic
1182110486 22:27719658-27719680 GGGAGGGTAAGAGGCATGTGGGG - Intergenic
1183083668 22:35473446-35473468 GAGAGGGTAGGAGGCCTGTGGGG + Intergenic
1183726813 22:39594519-39594541 GAGAGTGGCAGTGGGGTGAGGGG + Intronic
1184753508 22:46502765-46502787 GAGAGAGTCAGGAGAGTGTGGGG - Intronic
1184898752 22:47430549-47430571 GACAGTGCCAGATGCTTGTGTGG + Intergenic
1185409824 22:50675974-50675996 GAGAGTGCCAGAGGGGTGTGTGG + Intergenic
950749421 3:15117092-15117114 GAGAGTGTAAGGGACTTGTGGGG + Intergenic
953185824 3:40637597-40637619 GAAAGGGTGAGAGGGGTGTGAGG + Intergenic
953554035 3:43928203-43928225 GAGAGAGTGGGAGGTGTGTGAGG - Intergenic
955983572 3:64550824-64550846 GAGAGTGGCAGAGGGATGAGTGG - Intronic
956717864 3:72094129-72094151 GAGACTGACAGAGAGGTGTGGGG + Intergenic
960473833 3:118099606-118099628 GAGAGTGGAAGAGGCGAGAGAGG + Intergenic
961756207 3:129128624-129128646 GGGGGTGGCAGAGCCGTGTGTGG - Intronic
968628558 4:1638663-1638685 GGGAGTGTCGGAGGGGTGGGGGG + Intronic
968774900 4:2534990-2535012 TTGGGTGTCAGAGGTGTGTGAGG + Intronic
970643011 4:18088596-18088618 GAGAGGGTCGGAGGTGGGTGAGG - Intergenic
974310862 4:60208769-60208791 GAGAGAGTCAGAAGGGTGGGGGG + Intergenic
976339540 4:83931826-83931848 GTGAGTTTCAGAGGTTTGTGGGG - Intergenic
978448411 4:108802944-108802966 CAGTGTGTCAGAGGAGTGAGTGG + Intergenic
980490099 4:133513445-133513467 GAGAGGGTGGGAGGGGTGTGAGG + Intergenic
982350255 4:154407672-154407694 GAGAGTCTCAGGGTTGTGTGGGG - Intronic
982751398 4:159166390-159166412 GGGTGTGGCAGAGGCCTGTGGGG + Intronic
989155475 5:38340787-38340809 GAGAGAGAGAGAGGCATGTGTGG - Intronic
990732175 5:58821177-58821199 GAGAGTGTCACAGTTGTGTAAGG - Intronic
991377812 5:65984492-65984514 GAGGGTGCCAGAGGCCTGGGTGG - Intronic
993671377 5:90764979-90765001 GAGATTGTCAGAGGAGTGAGGGG + Intronic
993751281 5:91671475-91671497 GAGAGTGTCAGAAGTCTGGGCGG - Intergenic
994021343 5:95029639-95029661 GAGATTGTCAGAGAGGTGAGAGG - Intronic
999766409 5:154744303-154744325 GAGAGTGTCATAGGTGAGAGTGG - Intronic
1005141326 6:22634865-22634887 GAGAGGGTGTGAGGAGTGTGAGG - Intergenic
1006252388 6:32798689-32798711 GAGAGGGTCAGAGACATGTGAGG + Intergenic
1006505309 6:34485460-34485482 GGGAGAGTCAGCGGGGTGTGGGG + Intronic
1013188921 6:107785541-107785563 GAGAGTGTGGGAGGCTTGGGAGG - Intronic
1016021286 6:139238741-139238763 GAGGGTTTCACAGGCGAGTGAGG - Intergenic
1017721200 6:157244253-157244275 GAGAGTCTCAGAGGCAACTGCGG - Intergenic
1017768308 6:157624994-157625016 GAGAGTGTGAGAGGCGGAGGGGG + Intronic
1019217445 6:170452776-170452798 GAGAGTGTCAGTGTGGGGTGAGG + Intergenic
1021239880 7:18187310-18187332 GAGAGTTTAAGAGGCATGTCTGG + Intronic
1022479581 7:30734137-30734159 GAGAAGGTCAGTGGGGTGTGGGG - Intronic
1022532433 7:31075472-31075494 GAGAGTGGCAGAGGATGGTGGGG - Intronic
1022643823 7:32212614-32212636 GAGTGTGTGAAGGGCGTGTGTGG - Intronic
1030080875 7:105776618-105776640 GAGAGTGTGAGAGGGGGGAGGGG + Intronic
1033615265 7:143008131-143008153 CCAAGTGTCAGAGGCGTGTGCGG - Intergenic
1035102251 7:156410394-156410416 CAGAGCCTCAGAGGCCTGTGGGG - Intergenic
1035364383 7:158337829-158337851 GTGAGTGTGAGTGACGTGTGTGG - Intronic
1035364665 7:158340607-158340629 GTGAGTGTGAGTGACGTGTGTGG - Intronic
1035364835 7:158342205-158342227 GTGAGTGTGAGTGACGTGTGTGG - Intronic
1038364818 8:26920256-26920278 GAGATTGTCAAAGTCCTGTGGGG - Intergenic
1041710856 8:60892942-60892964 GGGAGTCCCAGAGGAGTGTGCGG - Intergenic
1043794285 8:84516044-84516066 GAGAGTGGGAGAGGTGGGTGGGG + Intronic
1046490422 8:114945311-114945333 GAAAGTGTGGGAGGCGGGTGAGG - Intergenic
1048668712 8:136693416-136693438 TAGAGGGTCAGAGGAGGGTGAGG - Intergenic
1049684072 8:143932270-143932292 GAGCGTGGCAGAGCCGGGTGTGG - Intronic
1051350296 9:16192459-16192481 GAGGGAGGCAGAGGCGGGTGGGG - Intergenic
1060004938 9:119991714-119991736 TAGAGTGTCAGAGGTATCTGAGG - Intergenic
1060738659 9:126082928-126082950 GAGGAGGTCAGAGGGGTGTGTGG + Intergenic
1062054673 9:134464588-134464610 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054689 9:134464645-134464667 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054735 9:134464816-134464838 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054751 9:134464873-134464895 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054765 9:134464930-134464952 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054795 9:134465044-134465066 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054827 9:134465158-134465180 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054843 9:134465215-134465237 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054875 9:134465329-134465351 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054891 9:134465386-134465408 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054923 9:134465500-134465522 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054955 9:134465614-134465636 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062054971 9:134465671-134465693 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055033 9:134465899-134465921 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055047 9:134465956-134465978 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055077 9:134466070-134466092 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055125 9:134466241-134466263 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055157 9:134466355-134466377 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055173 9:134466412-134466434 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055189 9:134466469-134466491 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055203 9:134466526-134466548 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055217 9:134466583-134466605 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055231 9:134466640-134466662 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055245 9:134466697-134466719 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055259 9:134466754-134466776 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055272 9:134466811-134466833 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062055286 9:134466868-134466890 GAGCGGGGCAGAGGCGCGTGTGG - Intergenic
1062529273 9:136992783-136992805 GAGGGTGTCAGAGCCTTCTGGGG - Intronic
1062672783 9:137721382-137721404 GAGGGGGTGAGAGGCGTGGGAGG - Intronic
1062672790 9:137721401-137721423 GAGAGGGTGAGAGGCGTGGGAGG - Intronic
1188702548 X:33282540-33282562 GAGAGTGTCTTAGGCCTGTAGGG + Intronic
1189218695 X:39351092-39351114 GAAAGTGTGGGAGGCGGGTGAGG - Intergenic
1193865585 X:86726481-86726503 GAGATTGTCCTAGGGGTGTGTGG + Intronic
1194026916 X:88764181-88764203 CAGATTGTCAGAGGGGTGAGGGG - Intergenic
1194114996 X:89885685-89885707 GGGAGTGTCAGGGGCAAGTGGGG - Intergenic
1196754420 X:119145439-119145461 GAGGGTGGCAGGGGCATGTGGGG - Intronic
1199950404 X:152701507-152701529 GAGTGTGTTAGAGGTGTTTGAGG + Exonic
1199959277 X:152766954-152766976 GAGTGTGTTAGAGGTGTTTGAGG - Exonic
1199967165 X:152830401-152830423 GAGAGAGTCAGGGGCCTGTGAGG + Intronic
1200467785 Y:3542776-3542798 GGGAGTGTCAGGGGCAAGTGGGG - Intergenic