ID: 1180881664

View in Genome Browser
Species Human (GRCh38)
Location 22:19208475-19208497
Sequence AAGCAGATCCATAGCTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180881663_1180881664 13 Left 1180881663 22:19208439-19208461 CCAGATAACGTCTAGGAGGTCTT 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1180881664 22:19208475-19208497 AAGCAGATCCATAGCTCAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180881664 Original CRISPR AAGCAGATCCATAGCTCAGA AGG Intronic
903029910 1:20456525-20456547 AAGCATTGCAATAGCTCAGAGGG - Intergenic
905678034 1:39843686-39843708 AAGCAGAAGCATAGCTGGGAGGG - Intronic
912339520 1:108898136-108898158 CAGCAGATCCACGGCTTAGATGG - Intronic
913107655 1:115629389-115629411 GAGCAGCGCCAAAGCTCAGAGGG - Intergenic
913529074 1:119720610-119720632 AAGCTGATTCATAGCTTGGAAGG + Intronic
915902966 1:159859568-159859590 AAGCACTTACATAGCTCACATGG - Intronic
916631414 1:166618239-166618261 AAGCAAATTCAGAGCCCAGAGGG - Intergenic
920223400 1:204420874-204420896 CAGCATAACCATAGCCCAGAAGG - Intergenic
922037198 1:221860705-221860727 AGGAAGAACCATAGCTCAGGTGG - Intergenic
924688976 1:246326311-246326333 CAGCAGATCCATAGCAGTGAGGG + Intronic
1066596912 10:37061191-37061213 AAGCATTTTCATAGCTCAAATGG + Intergenic
1066707951 10:38201832-38201854 AGGCAGTACCATAGCTCACAGGG + Intergenic
1066981745 10:42422916-42422938 AGGCAGTACCATAGCTCACAGGG - Intergenic
1068121622 10:52786631-52786653 AAGCACCTCCTGAGCTCAGAAGG - Intergenic
1069640239 10:69950268-69950290 AAAGAGATCCATTGCACAGAGGG - Intronic
1071277172 10:84065887-84065909 AAGCAGGTCAAGAGCTCAGCAGG - Intergenic
1075904086 10:126065564-126065586 AAGCTGAGCCATTGGTCAGATGG - Intronic
1076291488 10:129349230-129349252 AAGCTGTTCCTGAGCTCAGAAGG - Intergenic
1076356258 10:129855870-129855892 GTGCAAATCCATTGCTCAGAGGG - Intronic
1078652688 11:13210309-13210331 ACGTATATTCATAGCTCAGAAGG + Intergenic
1079399234 11:20092446-20092468 AAGCAGATCAACAGATCAAATGG + Intronic
1082912723 11:58395302-58395324 CAACAGCTCCAGAGCTCAGAGGG + Intergenic
1084088775 11:66866744-66866766 CAGCAGATCTCTAGGTCAGAGGG + Intronic
1084902407 11:72319471-72319493 AAGAAGAGCCAAACCTCAGATGG - Intronic
1085663185 11:78388715-78388737 AAGGATATCCATAGCTCTGAGGG - Intronic
1085892710 11:80599939-80599961 AAGCATTTTCATAGCTCAAATGG - Intergenic
1086553388 11:88080472-88080494 CATCAGATCCATAGATCAGTTGG - Intergenic
1093209840 12:16295047-16295069 AAGAAAATCCTTAGCTGAGAAGG - Intergenic
1097908847 12:64948028-64948050 ACAGAGGTCCATAGCTCAGAAGG - Intergenic
1099298336 12:80859420-80859442 ATGCAGGTCTAAAGCTCAGAGGG + Intronic
1102428037 12:112859920-112859942 AATTAGATCCATAGCTGAGAAGG + Intronic
1103169475 12:118802757-118802779 AAGAAAATCCAAAGCTCAAATGG - Intergenic
1103740059 12:123085015-123085037 AACCAGATCCATTCCACAGATGG + Intronic
1104160255 12:126172221-126172243 AAGCACATCCAAAGCACTGAGGG + Intergenic
1104352918 12:128060196-128060218 ATGCAGCTGCGTAGCTCAGAGGG - Intergenic
1105064907 12:133188141-133188163 ATGGAGATCCTTAGGTCAGAGGG + Intronic
1106079214 13:26486750-26486772 AAGCAGAGCCAGAGCACAGTTGG - Intergenic
1106574165 13:30958648-30958670 AGACAGATCCACAGCTCACAGGG - Intronic
1108271978 13:48770608-48770630 AAGCAGATCCAAACCACTGAGGG + Intergenic
1109077383 13:57853675-57853697 AACCAGTACCATAGCTCAGCTGG + Intergenic
1109436226 13:62307064-62307086 AAGCAGACCCTTAGCTCTGAAGG - Intergenic
1110339549 13:74373282-74373304 AAGCAAATGCCTATCTCAGAAGG + Intergenic
1111180067 13:84652523-84652545 AAGCGGATCCATTGAGCAGAAGG + Intergenic
1117897993 14:60507695-60507717 AGGCAGATAGATAGCACAGATGG - Intronic
1120589462 14:86358105-86358127 AATCCTATCCAAAGCTCAGAGGG - Intergenic
1126246667 15:46514744-46514766 AAGCAGATCAATAACACATAAGG - Intergenic
1126418578 15:48446194-48446216 AAGCAAAACCATAGATAAGAGGG - Intronic
1129425533 15:75459754-75459776 AAGCTGATCCACAGATAAGAAGG - Intergenic
1130678178 15:85972986-85973008 TGGCTGATCCATAGCTCAGCAGG + Intergenic
1132237293 15:100231773-100231795 ATGCATACCCAAAGCTCAGAAGG - Intronic
1136713630 16:32259749-32259771 AAACAGATCTTTGGCTCAGATGG + Intergenic
1136754281 16:32669682-32669704 AAACAGATCTTTGGCTCAGATGG - Intergenic
1136813832 16:33200683-33200705 AAACAGATCTTTGGCTCAGATGG + Intronic
1136820308 16:33310763-33310785 AAACAGATCTTTGGCTCAGATGG + Intergenic
1136826871 16:33367302-33367324 AAACAGATCTTTGGCTCAGATGG + Intergenic
1136831937 16:33466073-33466095 AAACAGATCTTTGGCTCAGATGG + Intergenic
1137381772 16:48006049-48006071 TAGGAGGTCCATAGCTCACAGGG - Intergenic
1138962684 16:62046171-62046193 AGGAAGATCCATTGTTCAGAGGG - Intergenic
1140021581 16:71243908-71243930 AAGCAGATGGATATATCAGAGGG + Intergenic
1202992408 16_KI270728v1_random:23657-23679 AAACAGATCTTTGGCTCAGATGG + Intergenic
1203056428 16_KI270728v1_random:930013-930035 AAACAGATCTTTGGCTCAGATGG - Intergenic
1142836723 17:2593333-2593355 GAGCAGAGCCAGAGTTCAGAAGG + Intronic
1143678581 17:8457769-8457791 AATGAGATCCAAAGCACAGATGG - Intronic
1144619926 17:16811934-16811956 AAGCAGCTCTCAAGCTCAGAAGG - Intergenic
1144892760 17:18503770-18503792 AAGCAGCTCTCAAGCTCAGAAGG + Intergenic
1145139453 17:20440517-20440539 AAGCAGCTCTCAAGCTCAGAAGG - Intergenic
1149025906 17:52027222-52027244 AAGAAGAGCCAGAGCTCAGGTGG + Intronic
1150544732 17:66143758-66143780 TAACAGAAACATAGCTCAGAGGG + Intronic
1151366970 17:73623794-73623816 AAACAGATCCATACTGCAGAGGG + Intronic
1156782534 18:40868090-40868112 AAGCAGAACCATAGATAAGGAGG - Intergenic
1162454876 19:10777349-10777371 AAAAAGATACATAGCTCAAAGGG - Intronic
925527812 2:4822866-4822888 GATCAGACCCATATCTCAGAAGG + Intergenic
925656978 2:6159537-6159559 ATGGAGATCTATAGCCCAGAGGG - Intergenic
925927815 2:8682578-8682600 TAGGAGATCCGTAGCCCAGACGG + Intronic
928730604 2:34227517-34227539 CATCACATCCATAGCTCAAACGG - Intergenic
930768633 2:55110377-55110399 AAGCAGAGGCATAGCCCAAATGG + Intronic
931427994 2:62188627-62188649 AAGCAGGTCCTTTGCTCCGAAGG - Intergenic
933636415 2:84713419-84713441 AATCAGAATCAAAGCTCAGAAGG - Intronic
935886484 2:107624958-107624980 AAAAAGATCAAAAGCTCAGAGGG + Intergenic
936152706 2:110030395-110030417 AACCAGGTGCATATCTCAGAGGG - Intergenic
936191974 2:110341017-110341039 AACCAGGTGCATATCTCAGAGGG + Intergenic
940079387 2:149783092-149783114 AATCAGAGGCATATCTCAGAAGG + Intergenic
940195025 2:151084417-151084439 AAGGAGGTGCATAGCTCATAAGG + Intergenic
943518585 2:188918630-188918652 AATCAGGTCAATAACTCAGAGGG - Intergenic
943739515 2:191396083-191396105 AAGCAGATGCAGAACTCAGTGGG + Intronic
943908077 2:193526053-193526075 AAGCAACTGCATAGCTTAGAGGG - Intergenic
945416900 2:209585102-209585124 ATGCAGATCCAAAGCTGAGAAGG + Intronic
945993275 2:216414135-216414157 AAGCAAATCCAAAGCTAAAAAGG - Intronic
946441199 2:219697991-219698013 AAGGCGAGCCAGAGCTCAGAAGG + Intergenic
948448967 2:238057294-238057316 AAACACATCCATACATCAGAAGG - Intronic
1175387018 20:58603969-58603991 GAGCAGCACCATAGCTCGGATGG + Intergenic
1180881664 22:19208475-19208497 AAGCAGATCCATAGCTCAGAAGG + Intronic
1183323921 22:37181131-37181153 AAGCAGACCCAGAGCTCATGGGG - Exonic
1184819768 22:46901035-46901057 AAGCAAAAACATATCTCAGATGG - Intronic
950270374 3:11610042-11610064 AAGCAAAACCATAGCTCGGTCGG + Intronic
950644528 3:14369159-14369181 AAACAGATGCAGAGCTGAGAGGG - Intergenic
952486253 3:33814022-33814044 AATCATAACCATAGGTCAGAAGG + Intronic
952858770 3:37794946-37794968 CAGCAGAACCATGCCTCAGATGG - Intronic
956684264 3:71809769-71809791 AATCAGATGAAGAGCTCAGACGG + Intergenic
957701332 3:83718096-83718118 AAGAAGATCTATACTTCAGAAGG + Intergenic
957804072 3:85124101-85124123 AAGTAGATCCCTAACTTAGAAGG - Intronic
958463758 3:94432354-94432376 AAACATATCCTTTGCTCAGAAGG + Intergenic
959524678 3:107363425-107363447 AAGCACATCTATGGGTCAGAAGG - Intergenic
959956277 3:112241743-112241765 AAACAGATACATAGCTCAATGGG + Intronic
961051098 3:123747744-123747766 GAGGAGATCCAGACCTCAGATGG - Intronic
961490180 3:127251796-127251818 AAGAAAATCCAGAGCTCAAATGG - Intergenic
962078732 3:132114609-132114631 TAGCATATCCATAGCTGTGATGG - Intronic
962298084 3:134212156-134212178 AAGTAGATCCAGAGGTCAAATGG - Intronic
962455705 3:135563755-135563777 AACCTGATCCACAGCTGAGAGGG - Intergenic
962801946 3:138898029-138898051 ACGCAGCTCCAAAGCTCAGAAGG - Intergenic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
971355661 4:25893128-25893150 GATCAGATCCAGAGATCAGAGGG - Intronic
978657922 4:111088597-111088619 AAGCAGAACAAAAGCCCAGAAGG + Intergenic
981781639 4:148437532-148437554 AAGATGGTCCATATCTCAGAAGG + Intronic
982218976 4:153108502-153108524 AAGCAGACACATAGATCAGTGGG + Intergenic
985973573 5:3396675-3396697 AAGCAGATGCAATGCTTAGAAGG + Intergenic
986362008 5:6987884-6987906 AAGCAGCTGCACAGCCCAGAGGG - Intergenic
988200790 5:28066330-28066352 AAGCTGATGTATAGCCCAGAGGG + Intergenic
990536993 5:56732899-56732921 ACGCAGATCCACAGATCTGATGG - Intergenic
993461033 5:88182157-88182179 AAGAAAATTCATAGCCCAGATGG - Intergenic
997359761 5:133287585-133287607 AAGCAGATCCAGGGCTGAGCTGG - Intronic
998320332 5:141224293-141224315 ATCCAGATCCTTAGCTGAGATGG - Exonic
1000079944 5:157835448-157835470 AAGCAGAACCATTGCTCCTAGGG - Intronic
1006411285 6:33875354-33875376 TAGAAGTTCCTTAGCTCAGAGGG - Intergenic
1007940941 6:45780950-45780972 AAGAAAATTCAGAGCTCAGATGG + Intergenic
1008723642 6:54390062-54390084 AAGCAGAAGCATAGACCAGAGGG - Exonic
1009872445 6:69468492-69468514 AAACACATCCAAACCTCAGAAGG + Intergenic
1017672835 6:156783112-156783134 AAGCAGAGCCAAAGCAAAGAGGG - Intronic
1020404293 7:7814446-7814468 AAGCAGATGCATATCTCATAAGG - Intronic
1020620612 7:10514472-10514494 AGGCAGATCCAATGCTAAGAGGG - Intergenic
1020891595 7:13885019-13885041 AAACAGATCCAGCCCTCAGAAGG + Intergenic
1024803816 7:53112152-53112174 AAGCAGATCCCTATCATAGAGGG + Intergenic
1027535589 7:79396325-79396347 TAGCAGAGCCATAGAACAGAAGG + Intronic
1027691404 7:81351000-81351022 AAGCAGAACTGTGGCTCAGAAGG - Intergenic
1035812165 8:2501565-2501587 GAGCAGACCCATAGCTCAGGTGG + Intergenic
1037001151 8:13720512-13720534 AAGCACATACAGTGCTCAGAAGG + Intergenic
1037528337 8:19749727-19749749 AACCAAATCCCCAGCTCAGAGGG + Intronic
1039191470 8:34981039-34981061 AAGCAGTTCCAAAGCTTAGTGGG - Intergenic
1040072513 8:43200203-43200225 AGGCAGATACATAGGTAAGAGGG - Exonic
1040139796 8:43896730-43896752 AAGCATGTCCAAAGCACAGAGGG - Intergenic
1044506756 8:93029516-93029538 AATCTTATGCATAGCTCAGAAGG + Intergenic
1045444638 8:102248046-102248068 AAGCAGATACATTGTTCAGACGG + Intergenic
1056395011 9:86174071-86174093 AAGCAGATCCAGGGCCAAGATGG - Intergenic
1187823815 X:23315111-23315133 AGGCAGTCCCAGAGCTCAGAGGG - Intergenic
1189855694 X:45223284-45223306 AAACAGATACATAGATCAGTGGG - Intergenic
1191987995 X:67002671-67002693 AAGCAGATCATGAGCCCAGAAGG + Intergenic
1195349183 X:103980742-103980764 AGGCAGATCCATAGGACATAAGG + Intergenic
1195356551 X:104044838-104044860 AGGCAGATCCATAGGACATAAGG + Intergenic
1195358260 X:104058097-104058119 AGGCAGATCCATAGGACATAAGG - Intergenic
1197056609 X:122128404-122128426 ATGCAAATCCAAAACTCAGAAGG + Intergenic
1197056635 X:122128617-122128639 ATGCAAATCCAAAACTCAGAAGG - Intergenic
1198022278 X:132670878-132670900 CAGCAGAGCCAGAGCTCACATGG - Intronic
1198107346 X:133474285-133474307 AAGGACATCCATACCTCACATGG - Intergenic