ID: 1180883254

View in Genome Browser
Species Human (GRCh38)
Location 22:19221567-19221589
Sequence CTGGAGTCCCAGATTCAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 353}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180883254_1180883260 12 Left 1180883254 22:19221567-19221589 CCTTCCTGAATCTGGGACTCCAG 0: 1
1: 0
2: 3
3: 36
4: 353
Right 1180883260 22:19221602-19221624 CAGCTTGAGCCTTTGAAAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 136
1180883254_1180883261 16 Left 1180883254 22:19221567-19221589 CCTTCCTGAATCTGGGACTCCAG 0: 1
1: 0
2: 3
3: 36
4: 353
Right 1180883261 22:19221606-19221628 TTGAGCCTTTGAAAGAAGGAAGG 0: 1
1: 0
2: 2
3: 26
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180883254 Original CRISPR CTGGAGTCCCAGATTCAGGA AGG (reversed) Exonic
900667883 1:3827851-3827873 CTGGAGCCCCAGCTCCATGAGGG + Intronic
902066042 1:13688734-13688756 CTGTAGTCCCAGCTACTGGAAGG + Intergenic
902631662 1:17708271-17708293 CTAGAGGCTCAGATCCAGGAGGG - Intergenic
903263991 1:22145611-22145633 CCTGAGTCCCAGGCTCAGGATGG - Intergenic
903609027 1:24596559-24596581 CTGGAGTCCCAGCTACACGGGGG + Intronic
903779042 1:25810074-25810096 GGGGAGGCCCAGCTTCAGGAAGG - Intronic
904341338 1:29836909-29836931 CAAGGGTCCCAGGTTCAGGAAGG - Intergenic
904377235 1:30089639-30089661 CTGGGGGCTCAGAGTCAGGAGGG + Intergenic
906185756 1:43860730-43860752 CTGGAGTGCTAGATGCAGAAAGG + Intronic
906188851 1:43882531-43882553 TTTGAGTCCTAGATTCAGGTGGG - Intronic
906266671 1:44436271-44436293 CTGTCCTCCCAGATTCAGAATGG - Intronic
906425950 1:45712734-45712756 CTGCAGTCCCAGCTACTGGAAGG + Intronic
907044085 1:51289098-51289120 CTGGAGCCCAAGGTACAGGATGG - Intronic
907339240 1:53722709-53722731 CTGCAGTCCCAGCTACTGGAAGG + Intronic
907358836 1:53898281-53898303 GTGGGGTCCCAGAGGCAGGAAGG + Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
909197274 1:72643457-72643479 CTGCACTCCTATATTCAGGAGGG - Intergenic
909334851 1:74460614-74460636 CTGGTATTACAGATTCAGGAAGG - Intronic
909389618 1:75105034-75105056 CTGCAGTCCCAGCTACTGGAAGG + Intergenic
909792011 1:79692004-79692026 CTGGAGTGCCAGGGTCATGAAGG + Intergenic
909877547 1:80828158-80828180 ATGGAGGCCCAGATTGAGGGTGG - Intergenic
910463248 1:87470134-87470156 CTGGATTTCCATATTTAGGAAGG + Intergenic
910613254 1:89167610-89167632 CTGGAGTCCCTCATTAATGATGG - Intronic
910924438 1:92384078-92384100 CTGTAGTCCCAGCTACAGGGAGG - Intronic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911906354 1:103573172-103573194 CAGCAGTCCCATATTCTGGATGG + Exonic
911909828 1:103619020-103619042 CAGCAGTCCCATATTCTGGATGG + Exonic
911912925 1:103657903-103657925 CAGCAGTCCCATATTCTGGATGG + Exonic
911913702 1:103668137-103668159 CAGCAGTCCCATATTCTGGATGG - Intronic
911915530 1:103694045-103694067 CAGCAGTCCCATATTCTGGATGG - Exonic
911920337 1:103752042-103752064 CAGCAGTCCCATATTCTGGATGG + Exonic
912183241 1:107243673-107243695 CTGTAGTCCCAGCTACTGGAAGG - Intronic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915169602 1:153968596-153968618 GTGGAGTCCCAGCTCCAGGACGG - Exonic
915347219 1:155203637-155203659 CTGGAGCCCCAGAATAAAGATGG + Intronic
915959308 1:160251593-160251615 CTGTAGTCCCAGCTACTGGAGGG - Intronic
916592459 1:166205707-166205729 CTGGATTCCAAGCTTCATGAGGG + Intergenic
917296210 1:173522103-173522125 CTGTAGTCCCAGCTACAGGCTGG + Intronic
917521559 1:175752121-175752143 CTGTAGTCCCAGCTACAGGTGGG + Intergenic
918239005 1:182605417-182605439 CTGAAGACCCAGCTGCAGGAAGG + Intergenic
918623021 1:186626487-186626509 CAGGAGTCACAGATTTGGGAAGG + Intergenic
921159902 1:212465345-212465367 CTGGGGTCCCAGCTTCTAGAAGG - Intergenic
921581558 1:216901873-216901895 CTGGAGTCCCAGATGCTTGGGGG - Intronic
923170741 1:231414856-231414878 CTGTAGTCCCAGCTTCTTGAGGG - Intronic
924440782 1:244083456-244083478 GTGGAGCTCCAGATTCAGGAAGG + Intergenic
1064019725 10:11799385-11799407 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
1064031926 10:11888022-11888044 CTGCAGTCCCAGCTACAGGTGGG + Intergenic
1064110957 10:12538613-12538635 ATGGAGTGCCAGTTCCAGGAAGG + Intronic
1065004110 10:21363831-21363853 CTTGATTTCCACATTCAGGAAGG - Intergenic
1065517677 10:26541063-26541085 GGGGACTCCCAGAGTCAGGATGG - Intronic
1065925860 10:30433692-30433714 CTGGAGTCCCAGGGTCCGGCGGG - Intergenic
1067902081 10:50252716-50252738 CTGCAGACCCAGGATCAGGATGG + Intergenic
1068990019 10:63140534-63140556 CTGTAGTCCCAGCTACAGGAGGG - Intronic
1069032202 10:63609327-63609349 CTGTAGTCCCAGCTACTGGAGGG + Intronic
1069791306 10:71023811-71023833 CTGGAGTCTGATATTCAGGGTGG + Intergenic
1070923656 10:80204725-80204747 CTTGATCCCCAGTTTCAGGAAGG - Intronic
1071711813 10:88057192-88057214 CTAGAGTGCAAAATTCAGGAAGG + Intergenic
1073199857 10:101726658-101726680 CTGTAATCCCAGCTTCCGGAAGG - Intergenic
1074520956 10:114223414-114223436 CTGGAGCCCAAGATTGAGGAAGG - Intronic
1076525499 10:131110073-131110095 CGGGAGTCTGAGGTTCAGGAAGG + Intronic
1076546520 10:131249087-131249109 CTGGATTCCCAGCATCAGGCTGG - Intronic
1077098675 11:811209-811231 CTGTAGTCCCAGACTGAGGTGGG + Intronic
1077176740 11:1194572-1194594 CTGGACTCCCAGCTCCGGGATGG - Intronic
1079503759 11:21131957-21131979 CTGGAGACACAGGTACAGGATGG + Intronic
1079543150 11:21600013-21600035 CTGCAGTCCCAGCTACAGGGAGG - Intergenic
1080223335 11:29932714-29932736 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
1080231165 11:30018290-30018312 CTGGAGTTACAGTTTGAGGAAGG + Intergenic
1080523713 11:33091834-33091856 CTGTAGTCCCAGATACTGGGAGG - Intronic
1081927592 11:46843606-46843628 CTGTAGTCCCAGCTACCGGAAGG + Intronic
1082892288 11:58152932-58152954 CTGGAATCCGAGCTCCAGGAGGG + Intronic
1083276689 11:61600877-61600899 CTGAAGCCCCAGACTCAGGTTGG - Intergenic
1083800141 11:65041752-65041774 CTGCAGGCCCAGGTGCAGGAGGG + Exonic
1083873460 11:65506896-65506918 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
1084331240 11:68431887-68431909 CTGGAGTTCCCGAGCCAGGAGGG - Intronic
1085789155 11:79481724-79481746 CTAGACTCTCAGTTTCAGGAAGG + Intergenic
1085867963 11:80317123-80317145 CTGTAGTCCAAGATTCTGAATGG + Intergenic
1086579293 11:88378838-88378860 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1087769447 11:102191791-102191813 CTGTAGTCCCAGCTACAGGCGGG - Intronic
1087833006 11:102840181-102840203 CTGGCGTCCCAGGTTCTGGAGGG + Exonic
1088195580 11:107270144-107270166 GTTGAGTCCCAGATTTTGGATGG - Intergenic
1089102325 11:115973952-115973974 CTGGAGTCACAGAAACTGGATGG - Intergenic
1089460195 11:118648526-118648548 CTGAAGTTCCACATGCAGGAGGG - Intronic
1089788714 11:120926799-120926821 CTAGAGTGCCATCTTCAGGAAGG - Intronic
1090051126 11:123380832-123380854 CTCCAGTCCCAGAATGAGGAGGG - Intergenic
1090401987 11:126454777-126454799 CTGGAGTCCCCGGCTCAGAAGGG + Intronic
1090822166 11:130352782-130352804 CTGTAGTCCCAGATACTGGGAGG - Intergenic
1091694924 12:2622066-2622088 CTGGAGGCCAAGAGCCAGGAAGG + Intronic
1091820230 12:3470613-3470635 CTGGAGACCCTGTTCCAGGAAGG - Intronic
1095411644 12:41931805-41931827 CTGCAGTCCCAGCTACCGGAAGG + Intergenic
1095580655 12:43793107-43793129 CTGTAGTCCCAGCTACAGGCTGG - Intergenic
1096004906 12:48161637-48161659 CTGGACACCCAGATTCAGGAGGG + Intronic
1097092584 12:56519039-56519061 CTGTAGTCCCAGCTACAGGGTGG + Intergenic
1097112720 12:56673838-56673860 CTGTAGTCCCAGATACTTGAGGG + Intronic
1097407658 12:59210961-59210983 CTGGAGTACCAAATTCAAAAAGG - Intergenic
1097633712 12:62096199-62096221 CAGGAATCCCAGATCCAGCAGGG - Intronic
1098659525 12:73075041-73075063 GTGGAGTCCAAGATGTAGGATGG + Intergenic
1099459871 12:82909316-82909338 CTGGAGTCCTGCATTCATGAAGG + Intronic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1102752340 12:115306421-115306443 CTGGAATGCCAGCTTCAAGAGGG - Intergenic
1102990644 12:117313415-117313437 CTGTAGTCCCAGCTACTGGAGGG - Intronic
1103040105 12:117687914-117687936 CTGGAGACCCAGGCTCAGAAAGG - Intronic
1104678679 12:130733349-130733371 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1108524000 13:51270132-51270154 CTGGGGTCTCTGATTCAGGCTGG - Intronic
1109043401 13:57373550-57373572 CTGCAGTCCCAGCTACAGGTAGG - Intergenic
1110985759 13:81965844-81965866 CTGTAGTCCCAGACACAGGGAGG - Intergenic
1113822607 13:113225722-113225744 CTGGAGTCAGAGCTGCAGGATGG + Intronic
1114466242 14:22924874-22924896 CTGCAGTCCCCGCTTCAGGTGGG - Exonic
1116962693 14:50982492-50982514 CTAGAGTCCTAGATGGAGGAGGG + Intronic
1117728689 14:58699141-58699163 CTGGAGTTCCAGTGTAAGGAGGG + Intergenic
1118036885 14:61877608-61877630 CTGGACTCCCAGATCCAGGCTGG + Intergenic
1118872327 14:69753708-69753730 CTGTAGTCCCAGCTACAGGGGGG - Intronic
1119038578 14:71251723-71251745 CTGTAGTCCCAGCTACAGGGAGG + Intergenic
1122260636 14:100518766-100518788 CTGTAGTCCCAGCTAGAGGACGG + Intronic
1122567898 14:102674935-102674957 CTGTAGTCCCAGCTACAGGCTGG + Intronic
1127209985 15:56764258-56764280 CTGCTGACCCACATTCAGGAAGG - Intronic
1127992748 15:64132928-64132950 CTGGAGAGCCAGCTGCAGGAAGG + Intronic
1128198024 15:65777910-65777932 CTGTAGTCCCAGCTACTGGAAGG + Intronic
1130516590 15:84630581-84630603 CTGGAGTCCCAGCTTCGTAAGGG + Intergenic
1130862216 15:87901099-87901121 CTGGAATCCCAGATGCTGCATGG - Intronic
1131951157 15:97683293-97683315 GTGGAGGTCCAGATTCAGTAGGG - Intergenic
1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG + Intronic
1132537955 16:492534-492556 TTGGAATCCAAGATTCTGGACGG - Intronic
1132953036 16:2575554-2575576 TCGGAGTCCCACCTTCAGGAAGG + Intronic
1132961315 16:2624614-2624636 TCGGAGTCCCACCTTCAGGAAGG - Intergenic
1133081518 16:3324707-3324729 CTGCAGTCCCAGATTTGGGGAGG - Intergenic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133947132 16:10357949-10357971 CTGGAACCCCAGATTCCAGAAGG - Intronic
1133950925 16:10391772-10391794 CTGTAGTCCCAGCTGCTGGAGGG + Intronic
1134040487 16:11064652-11064674 CTGTAGTCCCAGATACTTGAGGG + Intronic
1134132267 16:11657791-11657813 CTGGAGTCCCTGAGTGAGAAAGG - Intergenic
1135834724 16:25814854-25814876 ATGGAGCCACAAATTCAGGAAGG + Intronic
1135893449 16:26377246-26377268 CTGGATTCCCAGGCTCAGGCAGG + Intergenic
1137420856 16:48332587-48332609 CTGTAGTCCCAGCTACAGGGAGG + Intronic
1138278892 16:55757662-55757684 CTGGAGACCCAAATTCAAAAAGG - Intergenic
1138289642 16:55835926-55835948 CTGGAGACCCAAATTCAAAAAGG + Intergenic
1140470243 16:75209701-75209723 ATGGAGTCCCAGATCCAGGCTGG + Intergenic
1140721159 16:77773514-77773536 CTTGAGTCCCAGAGGTAGGAAGG + Intergenic
1142776588 17:2144831-2144853 CTGGAATCCCAGCTTTAGGCAGG + Intronic
1142909324 17:3073644-3073666 TTGGGATCCCAGATTCACGATGG + Intergenic
1142925236 17:3230594-3230616 TTGGGATCCCAGATTCACGATGG - Intergenic
1142966888 17:3587216-3587238 TTGGAGGCCCAGGTTCAGCATGG + Intronic
1143506809 17:7370747-7370769 CAGGAGTCCCAGATTAATGCAGG - Intergenic
1144887641 17:18474511-18474533 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
1145144575 17:20469789-20469811 CTGTAGTCCCAGCTACAGGGAGG + Intergenic
1145176027 17:20701191-20701213 CTGTAGTCCCAGCTACAGGGAGG + Intergenic
1145189507 17:20826713-20826735 CTGCAGTCCCAGATATTGGAGGG + Intergenic
1145367043 17:22273360-22273382 CTGAAATCCCTGAGTCAGGATGG - Intergenic
1145890051 17:28407845-28407867 CAGGAGTCCGAGACTCAGGATGG + Intergenic
1146369841 17:32258796-32258818 CTGGAGCTCCATATTCAGTATGG - Intergenic
1146408166 17:32557627-32557649 CTGTAGTCCCAGCTACTGGATGG - Intronic
1146565878 17:33912368-33912390 CTGTAGTCCCAGCTACAGGCAGG + Intronic
1147326587 17:39672587-39672609 CTCGAGTCCCAGATGCTGGGAGG + Exonic
1147768488 17:42852172-42852194 CTGGAGGCCCAGTTTGAGGCCGG + Exonic
1147771076 17:42868104-42868126 CTGGAGGCCCAGTTTGAGGCCGG + Intergenic
1147872591 17:43598147-43598169 CTGGGGTCCCAGGTTCACGCTGG + Intergenic
1148168053 17:45497574-45497596 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1148280764 17:46345383-46345405 CTGTAGTCCCAGATATTGGAGGG - Intronic
1148302992 17:46563318-46563340 CTGTAGTCCCAGATATTGGAGGG - Intronic
1148869286 17:50646660-50646682 CTGGGGTCCCAGATCCTGCATGG - Intronic
1148898791 17:50859057-50859079 CTGTAGTCCCAGCTACAGGCTGG - Intergenic
1150077394 17:62204219-62204241 CTGCAGTCCCAGATACTGGAGGG - Intergenic
1150282550 17:63937852-63937874 CTGTAGTCCCAGGCTCAGGTGGG + Intergenic
1150399237 17:64843990-64844012 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1150740119 17:67772581-67772603 CTGTAGTCCCAGCTACAGGGAGG + Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1155478805 18:26262877-26262899 CTGGAGTTCCACTTTCAGAATGG - Intronic
1155583428 18:27338389-27338411 CTATAGTCCCAGCTTCAGGAGGG + Intergenic
1159005171 18:63004663-63004685 GTGGAGACCCAGAGCCAGGAGGG + Intergenic
1159527594 18:69612991-69613013 CTGTAGTCCCAGCTTCAGGTGGG - Intronic
1160345550 18:78129120-78129142 CTGGAGCCCCAGAAGCTGGAGGG + Intergenic
1160735551 19:660754-660776 CTGGAGTCCCAGCTACTGGCGGG - Intronic
1160774050 19:846657-846679 CTGGAGTCCTGGATTCTGGAAGG - Intronic
1161053306 19:2176868-2176890 CTGGAATTCCAGCTTGAGGAGGG + Intronic
1162086743 19:8253980-8254002 TTGGAGGCCCAGAGTCAGAAAGG - Intronic
1164727608 19:30476827-30476849 CTGGAGTCCAAGAGGCAGGCAGG - Intronic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1166513087 19:43424110-43424132 CTGTAGTCCCAGCTACTGGAGGG - Intergenic
1166540523 19:43602340-43602362 CTGTAGTCCCAGCTACAGGGAGG - Intronic
1167289388 19:48615998-48616020 CTGGCCTCCCAGATCCAGGAGGG + Intronic
1167291335 19:48626691-48626713 CTGTAATCCCAGCTACAGGAGGG + Intronic
1167766207 19:51484280-51484302 CTGGACTACAAGATTCAGGAGGG + Intronic
1168092554 19:54095568-54095590 CTGGAGTCCTGGGTCCAGGAAGG + Exonic
1168306964 19:55441034-55441056 ATGGGGTCCCAGATTCAGGGTGG - Intronic
925333723 2:3077901-3077923 CGGGATTCCCAGATACAGGAGGG - Intergenic
926295023 2:11562760-11562782 CTGGAGCTCCTGTTTCAGGAGGG - Intronic
926395503 2:12438300-12438322 CTGGAGATTCTGATTCAGGAGGG + Intergenic
927625103 2:24707871-24707893 CTGGAGGCCCAGAGCCAGGTGGG + Exonic
927952040 2:27177572-27177594 CTGTAGTCCCAGGTACAGGAGGG - Intergenic
929551386 2:42895323-42895345 CTGGTGTCCCTGAGTCAGAAGGG - Intergenic
931263237 2:60638345-60638367 CTGGAGTCCCTGCATGAGGAGGG + Intergenic
931396823 2:61895318-61895340 GTGGAGCCCAAGATCCAGGAAGG + Intronic
932792010 2:74662074-74662096 CTGGAGTCCCTGGGTGAGGAAGG + Intronic
935905206 2:107831691-107831713 CTGTAGTCCCAGCTACAGGCTGG - Intronic
935991572 2:108723395-108723417 CTGTAGTCCCAGCTACAGGCTGG - Intronic
936126989 2:109796761-109796783 CTGTAGTCCCAGCTACAGGCTGG - Intronic
936217708 2:110574725-110574747 CTGTAGTCCCAGCTACAGGCTGG + Intronic
936426850 2:112429296-112429318 CTGTAGTCCCAGCTACAGGCTGG + Intronic
936468016 2:112771077-112771099 AGAGAGTCCCAGATTAAGGATGG - Intergenic
937473450 2:122193061-122193083 CTGCATTCCCAGATTCAGGGTGG + Intergenic
937992083 2:127669593-127669615 CTGTAGTCCCAGCTACTGGAGGG + Intronic
938010195 2:127822556-127822578 CTGGACTCCCTGCTTCAGAATGG - Intergenic
938387046 2:130873962-130873984 CTGGCTCTCCAGATTCAGGAGGG + Intronic
938892011 2:135715224-135715246 CTGTAGTCCCAGCTACAGGCTGG + Intronic
940206274 2:151205320-151205342 CTGGATCCCCAGAATCAGGTAGG + Intergenic
940853239 2:158707784-158707806 TAGAAGTCACAGATTCAGGATGG - Intergenic
941287353 2:163630637-163630659 CTGCATTCCCAGATTTAGCAAGG + Intronic
942441794 2:176044529-176044551 CTGTAGTCCCAGCTTCTTGAGGG - Intergenic
945452815 2:210013436-210013458 CTGCAGTCCCAGCTACTGGAGGG - Intronic
947561489 2:231157687-231157709 CTGTAGTCCCAGCTACAGGAGGG - Intronic
947651523 2:231790409-231790431 CTGAAGTCCCTGAATCAGAAGGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169140176 20:3223321-3223343 CAGGGAGCCCAGATTCAGGAAGG - Intronic
1169232957 20:3905026-3905048 CTGGAGCCCCAGAATCAGGATGG - Intronic
1169911483 20:10651083-10651105 ATGGACTCCCCGATTCTGGAGGG + Intronic
1170549057 20:17460068-17460090 CTGGATTCCCTGATTCACAATGG - Intronic
1171088450 20:22261749-22261771 CTGGTGTCCCCATTTCAGGAAGG - Intergenic
1172077920 20:32313827-32313849 CTGTAGTCCCAGATACTCGAAGG - Intronic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172183005 20:33015005-33015027 ACGGAGGCCCAGAGTCAGGAAGG + Intronic
1172405705 20:34687323-34687345 CTTGGGTCTCAGATTGAGGAGGG - Intergenic
1172763756 20:37339854-37339876 CCTGAGTTCCAGATTCAGGAAGG + Intergenic
1172905887 20:38369011-38369033 CTGGAGTTCCAGGTTCATGTTGG - Exonic
1173256787 20:41399506-41399528 TAGGAGTGCCAGATTTAGGAGGG - Intergenic
1173275991 20:41583024-41583046 CTGGAGTCCCAGATGGCAGAAGG + Intronic
1173858509 20:46266853-46266875 CTGGAGCCCCAGATTCAGTAAGG + Intronic
1174327605 20:49791687-49791709 CTGTAGTCCCAGGCTGAGGAGGG + Intergenic
1174847023 20:53952314-53952336 CTGGACTCCCAGCTCCATGAGGG - Intronic
1175296594 20:57913092-57913114 CTGGAGTCTAAGATTCCTGAGGG - Intergenic
1175764043 20:61580963-61580985 CTGGAATCCATGCTTCAGGACGG - Intronic
1175818576 20:61896362-61896384 CAGGAGGCCCAGATGCGGGACGG - Intronic
1177641992 21:23855452-23855474 CTGGAGACCTAGCTTCATGAAGG - Intergenic
1178582964 21:33851277-33851299 ATGGAGACCCAGCCTCAGGAGGG + Intronic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1181349943 22:22247717-22247739 ATGGAATCCCAGAATCATGAAGG - Intergenic
1181974552 22:26719711-26719733 CTGTAGTCCCAGTTACAGGCTGG + Intergenic
1183896958 22:40977159-40977181 CTGGAGCCTCAGAACCAGGAGGG + Intergenic
1184090600 22:42291096-42291118 ATGGAGTCCCAGAGACGGGAAGG - Intronic
949905088 3:8852480-8852502 CTGGAGCCCTGGATTCTGGAGGG + Intronic
950668593 3:14511936-14511958 CTGGAGTGCCAGCTCCAGGAGGG - Intronic
950674123 3:14544491-14544513 CTGGAGTCAGAGATGAAGGACGG - Intergenic
951059035 3:18183117-18183139 TTGGAGTCCCAGATTGAGGGTGG - Intronic
951085512 3:18508431-18508453 CTAGAGTCCAAGGTCCAGGAAGG - Intergenic
951086033 3:18514108-18514130 CTGGAGTTCCAAATTCAAAATGG - Intergenic
952314635 3:32221938-32221960 CTGAAGCCTCAGCTTCAGGAAGG + Intergenic
953328057 3:42029359-42029381 CTGCAGTCCCAGCTACTGGAGGG - Intronic
955520132 3:59767597-59767619 CTGGAGCCCAACATTAAGGATGG + Intronic
955921633 3:63963036-63963058 CTGTAGTCCCAGGTACTGGAAGG - Intronic
955974865 3:64470058-64470080 CTGGACTCCAAGCTCCAGGATGG + Intergenic
956286731 3:67618295-67618317 CTGTAGTCCCAGCTACAGGGAGG + Intronic
956514615 3:70033290-70033312 CTTGAGCCCCTGATTCAGGCTGG + Intergenic
956625659 3:71264050-71264072 CAGGAAACCCAGATTCAGAAAGG + Intronic
956684011 3:71807518-71807540 CTGTAGTCCCAGCTACATGAGGG - Intergenic
956790474 3:72676299-72676321 CTGGAGTCACAAATTTTGGAGGG + Intergenic
957680190 3:83424018-83424040 GTGGAGTACCAGATGAAGGAAGG + Intergenic
957786838 3:84893496-84893518 CTTGAGTCCAAGATTCAGGTTGG - Intergenic
958579320 3:95997152-95997174 CTGGATTCCCAGATATAGAAAGG - Intergenic
959781464 3:110239119-110239141 GTGGAGGCCTAGCTTCAGGATGG - Intergenic
962257358 3:133881531-133881553 CTGGAGGCCCAGCTTCTAGAAGG + Intronic
962448355 3:135490108-135490130 CAGGATTTCCACATTCAGGATGG + Intergenic
963123478 3:141795081-141795103 CTGGAGTCACAGGGTCAGGAAGG + Intronic
964069210 3:152611510-152611532 CTGTAGTCCCAGCTACAGGTGGG - Intergenic
965550533 3:169960507-169960529 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
966405026 3:179587744-179587766 CTGGAGTCCCAGGCTGAGGTGGG + Intronic
967733992 3:192933206-192933228 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
967823845 3:193862952-193862974 TTGGAGTCCCAGACTGAGGCAGG - Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968280313 3:197472120-197472142 CAGGAGGCCCAAATTCAGCAAGG + Intergenic
969294408 4:6261329-6261351 CTGTAGTCCCAGCTACAGGGTGG + Intergenic
971398288 4:26250936-26250958 ATATAGTCCCAGACTCAGGAAGG - Intronic
974159533 4:58119822-58119844 CTGTAGTCCCAGCTACATGAGGG - Intergenic
975051365 4:69868749-69868771 TTGGAGACCCGGATTCAGTATGG + Intergenic
975914646 4:79309836-79309858 CTGTAGTCCCAGCTACTGGAGGG - Intronic
976089026 4:81435899-81435921 CTGTAGTCCCAGGTATAGGAGGG - Intronic
976310034 4:83602208-83602230 CTGTAGTCTCAGACACAGGAAGG + Intronic
977622880 4:99156892-99156914 TTGGGGTCCCAGATCTAGGATGG + Intronic
980164113 4:129203545-129203567 TTAGAGACCAAGATTCAGGAAGG - Intergenic
980916122 4:139034692-139034714 CTGTAGTCCCAGCTTCTTGAGGG - Intronic
981690291 4:147500593-147500615 CTGCAGTCCCAGCTACTGGAAGG + Intronic
981772777 4:148329112-148329134 CTGGAGTCTCACACTCAGGCTGG - Intronic
982520762 4:156414010-156414032 CTGGAGTGGCAGATTTAAGATGG - Intergenic
984098425 4:175460072-175460094 GTGAAATCCCAGAATCAGGAAGG + Intergenic
984248135 4:177300331-177300353 CTGGAGTCAAAGAATCAGTAGGG + Intergenic
984947308 4:184979874-184979896 CTAGACTCCCAGCTTCATGAGGG + Intergenic
986167574 5:5288843-5288865 CTGGAGTGGCAGGATCAGGAAGG - Intronic
986776123 5:11015764-11015786 CTGGAGCCACTGATTCAGAATGG + Intronic
987026028 5:13927367-13927389 CTGTAGTCCCAGCTACAGGCTGG + Intronic
988434107 5:31153537-31153559 CTGGAGAGCCAGGTTCAGGGAGG - Intergenic
989096477 5:37786302-37786324 CTAGAGTCAGAGAATCAGGATGG - Intergenic
989219271 5:38937153-38937175 CTGTAGTCCCAGCTACAGGGAGG - Intronic
992644933 5:78803219-78803241 CTGGAGTTCCAGCTTCAACATGG - Intronic
992751328 5:79865479-79865501 CTGTAGTCCCAGGTTGAGGTGGG - Intergenic
994010495 5:94896924-94896946 CCAGAGTCCCAGGTTCAGGTGGG - Intronic
994458049 5:100039196-100039218 CTGGAATCCCATATTCAAGAAGG + Intergenic
994835419 5:104845904-104845926 CTGGATTCCCTGATGCAGAAAGG + Intergenic
994877743 5:105447137-105447159 CTGGAATCCCAGGTTCCTGACGG - Intergenic
995109423 5:108412417-108412439 CTGTAGTCCCAGCTACTGGAGGG - Intergenic
997792884 5:136778112-136778134 GTAAAGTCCCAGATTCATGAGGG + Intergenic
999162219 5:149511204-149511226 CTGTAGTCCCAGCTACAGGTAGG + Intronic
999681048 5:154060476-154060498 CTGTAGTCCCAGCTACAGGCAGG - Intronic
1000834317 5:166135422-166135444 CTGGAGGCCCAGATGCTGGGAGG + Intergenic
1001880556 5:175240482-175240504 CTGGTGTCGCAGACTGAGGAGGG - Intergenic
1001915854 5:175559439-175559461 CTGCAGTCCCAGCTACAGGCTGG - Intergenic
1003985683 6:11432235-11432257 CAAGACTCCCAGATTCAAGAAGG + Intergenic
1004036454 6:11929032-11929054 CTGTACTCCCAGCTACAGGAGGG - Intergenic
1004415276 6:15417619-15417641 CTGTAGTCCCAGTTACAGGAGGG + Intronic
1004636364 6:17471916-17471938 CTGGATTGACAGTTTCAGGAAGG + Intronic
1004702141 6:18089144-18089166 CTGGAATCCCAGAGTCAGAAGGG - Intergenic
1006354487 6:33546676-33546698 CTGTAGTCCCAGATACAGGCAGG - Intergenic
1006647798 6:35527016-35527038 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1006990887 6:38213858-38213880 CTGTAGTCCCAGCTACAGGCTGG + Intronic
1007473419 6:42104885-42104907 CTGGCGGCCCAGATACTGGAGGG + Exonic
1007567611 6:42864447-42864469 GTGGAGCCCCAGCTTCAAGATGG - Intronic
1007655787 6:43450302-43450324 CTGGCGTTCCAGATGCAAGAGGG - Exonic
1008927275 6:56900131-56900153 CTGGAGTTCTAGAATGAGGATGG - Intronic
1008936101 6:56994334-56994356 CTGTAGTCCCAGCTACTGGAAGG + Intronic
1010934563 6:81845837-81845859 CTGGAATCCCAGAATAAGGGAGG + Intergenic
1011553799 6:88554007-88554029 TTGGAGTCTCAGATGCAGGACGG - Intergenic
1017603171 6:156105383-156105405 CTGTAGTCCCAGATACTTGAAGG + Intergenic
1019490951 7:1313071-1313093 CTGTAGTCCCAGTTACATGAGGG - Intergenic
1021088680 7:16454686-16454708 GTGGAGACCCAGCTTCAGGAGGG - Intergenic
1021442544 7:20693242-20693264 CTGTAGTCCCAGCTACTGGAAGG + Intronic
1021689340 7:23217093-23217115 CTGTAGTCCCAGATACTGGGTGG - Intergenic
1021789136 7:24182892-24182914 CTGTAGTCCCAGCTACACGAGGG + Intergenic
1022033778 7:26515731-26515753 CTGGAGTCCCAGGCCCAGCAGGG + Intergenic
1022527987 7:31050613-31050635 CAGGAGTCTCAGAGTCAAGAGGG - Intergenic
1022561878 7:31358048-31358070 CTGGGGTCCTAGATTTAGGGAGG + Intergenic
1022706845 7:32809791-32809813 CTGCAGTCCCAGCTACTGGAGGG + Intergenic
1022866303 7:34425103-34425125 TGGGAGTCCAAGATTCAGGTAGG + Intergenic
1023853177 7:44162167-44162189 CTGGAGGCCCAGATTCTAAAGGG + Intronic
1024589703 7:50870742-50870764 CTGGAGTCACACATCCTGGAAGG + Intergenic
1026204328 7:68242644-68242666 CTGTAGTCCCAGCTACTGGAAGG - Intergenic
1026826969 7:73590044-73590066 CTGTAGTCCCAGCTACTGGAAGG + Intergenic
1027734903 7:81920337-81920359 CAGGACTACCAGCTTCAGGAAGG - Intergenic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028598645 7:92575349-92575371 CTGTAGTCCCAGCTACAGGGAGG + Intronic
1028611133 7:92712979-92713001 CTGTAGTCCCAGCTACAGGCTGG - Intronic
1029602717 7:101578557-101578579 CTGTAGTCCCAGATACTGGAAGG + Intergenic
1029712086 7:102305143-102305165 CTGGAGCCCCCGACTCAGAACGG - Intronic
1029806854 7:103007137-103007159 CTGGAGTCCCAAAAAGAGGAAGG + Intronic
1029971792 7:104796852-104796874 CAGGAGACCCAGTCTCAGGATGG - Intronic
1030507553 7:110443918-110443940 CTGGATTCAAAGATGCAGGAGGG - Intergenic
1031476394 7:122227829-122227851 CTGTAGTCCCATATTTAGGAGGG - Intergenic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1032540031 7:132695148-132695170 CTGGGGTCCCAGAGCCAGGCAGG - Intronic
1033097021 7:138441090-138441112 CTGGAGGCCAAGATGCAGCATGG + Intergenic
1033177817 7:139141730-139141752 CTGGACTGCCTGTTTCAGGATGG + Intronic
1034252154 7:149701348-149701370 CTGGACTACCAGCTACAGGAAGG - Intergenic
1035472909 7:159121451-159121473 CTGGGGTCTCAGATTCATTATGG - Intronic
1036295152 8:7529019-7529041 CTAGAATCCCAGTTTCTGGATGG - Intergenic
1036327411 8:7791972-7791994 CTAGAATCCCAGTTTCTGGATGG + Intergenic
1036608214 8:10326898-10326920 CTGGAGTCACATTCTCAGGATGG - Intronic
1038272809 8:26089675-26089697 CTGAAGACGTAGATTCAGGAAGG - Intergenic
1040039123 8:42897852-42897874 CTGAAGACCCGGCTTCAGGAAGG - Intronic
1041477101 8:58278799-58278821 CTGGAGCTCCAGATGCAGGCAGG - Intergenic
1041689310 8:60673607-60673629 CTGTAGTCCCAGCTACTGGAAGG - Intergenic
1042274707 8:66992171-66992193 GTGGAGTCAGAGATTCATGAAGG - Intronic
1045791103 8:105985655-105985677 CTGTAGTCCCAGCTACAGGAGGG - Intergenic
1046197998 8:110888676-110888698 CTTAAGTCCCAGAATCAGAAAGG - Intergenic
1046989650 8:120437598-120437620 CTCAAGTCCCAAATTCAAGAGGG + Intronic
1047668503 8:127118994-127119016 CTGTAGTCCCAGCTACAGGAGGG - Intergenic
1047906580 8:129479245-129479267 GTGGGGTCACAGATACAGGAGGG - Intergenic
1048573437 8:135672999-135673021 CTGGAGAATCAGATTCAGGGCGG - Intergenic
1049971144 9:823190-823212 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
1052936252 9:34095508-34095530 CTGTAGTCCCAGCTACTGGAGGG - Intronic
1052936714 9:34099352-34099374 CTGTAGTCCCAGCTACAGGCTGG - Intronic
1053238609 9:36477698-36477720 CTGTAGTCCCAGCTACAGGGAGG + Intronic
1053382632 9:37661233-37661255 CTAGAGTCACAGAGGCAGGAGGG + Intronic
1053466312 9:38311268-38311290 CTGGAATCCAAGCTTCTGGAGGG - Intergenic
1056134093 9:83614226-83614248 CTGTAGTCCCAGCTACTGGATGG - Intergenic
1056554190 9:87675641-87675663 CTGGAGCCTCAGGGTCAGGATGG + Intronic
1058703298 9:107618819-107618841 CTGTAGTCCCAGATTCTTGGGGG - Intergenic
1058791377 9:108449276-108449298 TTGGATTCCCAGATGCTGGATGG + Intergenic
1059653146 9:116334053-116334075 CTGGAGTCCCATTATTAGGAAGG + Intronic
1061661334 9:132132305-132132327 TCAGAGTCCCAGTTTCAGGAGGG + Intergenic
1061723711 9:132569856-132569878 CTGTAGTCCCAGCTACAGGGAGG - Intronic
1062435630 9:136545557-136545579 CTGGAGTCCCGGGATCAGGGAGG - Intronic
1187040995 X:15595598-15595620 CTGATGTTCAAGATTCAGGAGGG - Intronic
1187395164 X:18912954-18912976 CTGTAGTCCCAGCTACTGGAGGG + Intronic
1187852381 X:23604009-23604031 GAGGAGGCCCAGAGTCAGGATGG - Intergenic
1188098324 X:26049823-26049845 GTGGAGTCCAAGATTTGGGAAGG - Intergenic
1188848573 X:35104094-35104116 GTGCATTCCCAGATTGAGGATGG - Intergenic
1189280517 X:39817554-39817576 CTGGTTTCCCAGAAACAGGAGGG + Intergenic
1190101288 X:47524468-47524490 CTGCAGTCCCAGACTAAGGAAGG + Intergenic
1190278411 X:48913887-48913909 CTGTGGTCCCTGATTCTGGAGGG - Exonic
1190832599 X:54072860-54072882 CTGAAGTCCCAGAAACAGGCAGG + Exonic
1190976557 X:55408660-55408682 CAGGAGGCCCACATTCTGGAGGG - Intergenic
1192453568 X:71258987-71259009 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
1192465831 X:71355169-71355191 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1192490331 X:71570914-71570936 CTGTAGTCCCAGCTACTGGAAGG - Intronic
1194998844 X:100622257-100622279 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic
1201349669 Y:13025849-13025871 CTGGAGTTCCAGAGGAAGGAAGG - Intergenic
1201494914 Y:14582636-14582658 CTGTAGTCCCAGCTTCTTGAGGG + Intronic