ID: 1180883810

View in Genome Browser
Species Human (GRCh38)
Location 22:19225354-19225376
Sequence TTTGCAGGAAGGCCGTCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180883800_1180883810 23 Left 1180883800 22:19225308-19225330 CCACCGACTGAGCACCCAAGGCA 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1180883810 22:19225354-19225376 TTTGCAGGAAGGCCGTCTTAAGG 0: 1
1: 0
2: 0
3: 6
4: 75
1180883805_1180883810 -1 Left 1180883805 22:19225332-19225354 CCAGTGCTGCATCCTGCCTGGCT 0: 1
1: 0
2: 6
3: 48
4: 484
Right 1180883810 22:19225354-19225376 TTTGCAGGAAGGCCGTCTTAAGG 0: 1
1: 0
2: 0
3: 6
4: 75
1180883802_1180883810 9 Left 1180883802 22:19225322-19225344 CCCAAGGCAGCCAGTGCTGCATC 0: 1
1: 0
2: 4
3: 21
4: 219
Right 1180883810 22:19225354-19225376 TTTGCAGGAAGGCCGTCTTAAGG 0: 1
1: 0
2: 0
3: 6
4: 75
1180883801_1180883810 20 Left 1180883801 22:19225311-19225333 CCGACTGAGCACCCAAGGCAGCC 0: 1
1: 0
2: 0
3: 15
4: 211
Right 1180883810 22:19225354-19225376 TTTGCAGGAAGGCCGTCTTAAGG 0: 1
1: 0
2: 0
3: 6
4: 75
1180883803_1180883810 8 Left 1180883803 22:19225323-19225345 CCAAGGCAGCCAGTGCTGCATCC 0: 1
1: 0
2: 4
3: 31
4: 268
Right 1180883810 22:19225354-19225376 TTTGCAGGAAGGCCGTCTTAAGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180883810 Original CRISPR TTTGCAGGAAGGCCGTCTTA AGG Intronic
900790385 1:4675987-4676009 TTAGGAGGAAGCCCGTCTTGTGG + Intronic
904956106 1:34285196-34285218 TTTCCAGGAAGGGAGGCTTATGG + Intergenic
908401868 1:63779060-63779082 GTTTCAGCAAGACCGTCTTAGGG - Intronic
911355664 1:96816197-96816219 TTGGAAGGAAGGCCGTATTAGGG - Intronic
923013134 1:230104805-230104827 TTTGCAGGAAGCCACTCTGAAGG + Intronic
924146442 1:241080834-241080856 TTTCAAGGAATGCCTTCTTATGG + Intronic
1064142726 10:12804119-12804141 TTTGCAGTAAAGCCTTCTGATGG - Intronic
1069557889 10:69409257-69409279 TTTGCAGGGAAGCCGTCTCCTGG - Intronic
1075789135 10:125070988-125071010 TTTGCAGGAATGCAGTGTGAGGG - Intronic
1081873436 11:46393297-46393319 AGTGCAGGAGTGCCGTCTTAGGG - Intergenic
1087200244 11:95337765-95337787 TTTCTAGGAAGGCAGTCTTCTGG + Intergenic
1099197531 12:79635605-79635627 TTTTCAGGATAGCCGTCTTCTGG - Intronic
1105862244 13:24425897-24425919 TTTGCAGGCAAACCCTCTTAGGG + Intronic
1106034204 13:26029039-26029061 TTTGCAGGCAGCTCCTCTTAAGG - Intergenic
1113285997 13:108849577-108849599 TTTGGAGGAAGGCAGTCTAGGGG - Intronic
1113286016 13:108849768-108849790 TTTGGAGGAAGGCAGTCTAGGGG - Intronic
1113466307 13:110515705-110515727 TTTCCAGGAAGGCAGCCTCAAGG - Intergenic
1113825989 13:113254107-113254129 TGTGCAGGAAGGGCTTGTTATGG + Intronic
1119755765 14:77118155-77118177 TTTGCAAACAGGCCGTCCTAAGG - Intronic
1123457433 15:20438928-20438950 TTTGCGGGAAGGCCTTCCAAAGG - Intergenic
1123660626 15:22561431-22561453 TTTGCGGGAAGGCCTTCCAAAGG + Intergenic
1124314424 15:28655668-28655690 TTTGCGGGAAGGCCTTCCGAAGG + Intergenic
1126746356 15:51829855-51829877 TTTCCAGGAAGTCCGTCTGCGGG + Intronic
1133313942 16:4870509-4870531 TTCGCAGGGGGGCCGTCTGAAGG + Exonic
1134649007 16:15893456-15893478 TCTGAAGGAAGGCAGTCTTGGGG + Intergenic
1136095522 16:27953002-27953024 TTTGCAGGAATGCAATCATATGG + Intronic
1136701934 16:32152450-32152472 TTTGCGGGAAGGCCTTCTGAAGG - Intergenic
1136765731 16:32775010-32775032 TTTGTGGGAAGGCCTTCTGAAGG + Intergenic
1136802367 16:33095368-33095390 TTTGTGGGAAGGCCTTCTGAAGG - Intergenic
1203068120 16_KI270728v1_random:1037258-1037280 TTTGCGGGAAGGCCTTCTGAAGG + Intergenic
1142890036 17:2937299-2937321 TTTGCAGGAAGGCATTCAGAAGG - Intronic
1151666904 17:75550252-75550274 TTTGCAGGAAGGCAGCCCTGGGG + Intronic
1152156552 17:78637454-78637476 TTTGCAGGAAGGCCTGATGAAGG - Intergenic
1153661283 18:7328441-7328463 TTTGCATGAAGGAATTCTTAAGG + Intergenic
1153874685 18:9358585-9358607 TTTGGAGGAGGGGGGTCTTAAGG + Intronic
1155615783 18:27719755-27719777 TTTGCAGGAGAGTCATCTTATGG - Intergenic
1156393159 18:36672072-36672094 TTGGCATGGAGGCCATCTTAGGG + Intronic
1157504479 18:48216985-48217007 TGCGCAGGAAGGCCGTGTGATGG + Intronic
1157514442 18:48300853-48300875 TTTGCAGCGAAGCCGTCCTATGG - Intronic
1159549907 18:69884133-69884155 CTTGCAGGCAGGCCGTCCTAAGG + Intronic
927004763 2:18836560-18836582 TTTGGAGCAAAGCCGTCTGATGG - Intergenic
937927175 2:127176292-127176314 TCTGTAGGAAGACAGTCTTACGG + Intergenic
1175086313 20:56462011-56462033 CTTGCAGGCAGGCCTTCATAAGG + Intergenic
1177921020 21:27152690-27152712 TTTGCAAGAAGGCAATCTGATGG - Intergenic
1180883810 22:19225354-19225376 TTTGCAGGAAGGCCGTCTTAAGG + Intronic
950680093 3:14579432-14579454 TTTGCAGGAAGGTTGCCTCAGGG - Intergenic
957386633 3:79503872-79503894 TTGGCAAAATGGCCGTCTTATGG + Intronic
960159968 3:114339664-114339686 TTTCCAAGAAAGCCGTTTTATGG - Intronic
964744764 3:160002006-160002028 TTTTCTGGAAGTCCTTCTTAGGG - Intergenic
966740420 3:183227677-183227699 TTTGCAGGAAGCCAGGCTTGCGG + Intronic
981740033 4:147991749-147991771 TTTGCAGGCAGGCCTTTCTAAGG + Intronic
985118301 4:186614301-186614323 TTTCCAGGAAGGACGTCTTCAGG + Exonic
992844887 5:80736513-80736535 CTTGCAGGAAGGCCTTTCTAAGG - Intronic
994809063 5:104489787-104489809 TTTGCAGAAAGGCACCCTTAAGG + Intergenic
998500771 5:142630677-142630699 TTTGTAGGAAGGCAGCCATATGG - Intronic
1000278166 5:159757945-159757967 TTTGCAGGAAGGACCTAGTATGG - Intergenic
1004189388 6:13450881-13450903 TTTGCAGGCAGGCCCTTATAAGG + Intronic
1005021419 6:21423038-21423060 TTTGTAGGCAGGTCGTCTTGTGG + Intergenic
1009831602 6:68943928-68943950 TATGGAGGAAGGCCGTGTGAAGG + Exonic
1015140715 6:129928331-129928353 TTGGCAGGAAGTCAGTCATATGG + Intergenic
1015829787 6:137356275-137356297 TTGGCAGGAAGACAGTGTTAAGG - Intergenic
1018315145 6:162549198-162549220 TTTGAAGGAGGGCCGTCTTCTGG - Intronic
1019215002 6:170437857-170437879 GCTCCAGGAAGGCCGTCTTGTGG - Intergenic
1020075295 7:5253902-5253924 AGAGCAGGAAGGCTGTCTTATGG + Intergenic
1024086581 7:45896737-45896759 TTTGCAGGAACTCAATCTTAAGG - Intergenic
1025203782 7:56979663-56979685 AGAGCAGGAAGGCTGTCTTATGG - Intergenic
1025668159 7:63597267-63597289 AGAGCAGGAAGGCTGTCTTATGG + Intergenic
1029041110 7:97575629-97575651 TTTGCAGCAAGACCGCCTGAGGG - Intergenic
1029103193 7:98151641-98151663 TTTCCAGAAAGGATGTCTTACGG + Intronic
1030928169 7:115483566-115483588 TTTCCAGGAAGATTGTCTTAGGG - Intergenic
1034975747 7:155448557-155448579 TTTTCAGGAAGTCCCTCTTGAGG + Intergenic
1037896023 8:22656492-22656514 TTTCCAGGTAGACAGTCTTAGGG + Intronic
1038562582 8:28593351-28593373 TTGGCAGCATGGCCATCTTAAGG + Intergenic
1042155012 8:65835380-65835402 ATTGCATGCAGGCCCTCTTAAGG - Intronic
1047334908 8:123926261-123926283 TTTGCATGACGGCCTTCTGAGGG + Intronic
1052107016 9:24531275-24531297 TTGGCAGGAAGGCAGGCTGAAGG + Intergenic
1062083577 9:134637098-134637120 TTTGCAGGAATCCAGTTTTAGGG + Intergenic
1186154049 X:6707474-6707496 TTTGCAGGAAAGCAAGCTTAGGG - Intergenic
1188253898 X:27935903-27935925 TCTGAAGGAAGGCTTTCTTAGGG + Intergenic
1195625926 X:107005836-107005858 TTTGCATTATGGCCTTCTTAGGG - Intergenic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1199371990 X:147060098-147060120 TTAGCAGGAAAGCTGTCTAAAGG + Intergenic