ID: 1180887577

View in Genome Browser
Species Human (GRCh38)
Location 22:19258061-19258083
Sequence CGACATCCATGGGCTCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 3, 1: 13, 2: 8, 3: 30, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180887573_1180887577 -1 Left 1180887573 22:19258039-19258061 CCATGCACCAGTTTGTGAGGAGC 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1180887577 22:19258061-19258083 CGACATCCATGGGCTCTGCAAGG 0: 3
1: 13
2: 8
3: 30
4: 113
1180887574_1180887577 -8 Left 1180887574 22:19258046-19258068 CCAGTTTGTGAGGAGCGACATCC 0: 1
1: 0
2: 2
3: 16
4: 71
Right 1180887577 22:19258061-19258083 CGACATCCATGGGCTCTGCAAGG 0: 3
1: 13
2: 8
3: 30
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180887577 Original CRISPR CGACATCCATGGGCTCTGCA AGG Intronic
902218891 1:14952107-14952129 CAGCAGCCATGGTCTCTGCAAGG + Intronic
903799953 1:25959412-25959434 GGAAATCTATGGGCTCGGCACGG + Intergenic
917598114 1:176550409-176550431 CGACAAACAAAGGCTCTGCAGGG - Intronic
918276709 1:182959805-182959827 TGACATCCAGGGGCTCCGCAAGG - Intergenic
922449302 1:225723937-225723959 CTGCAACTATGGGCTCTGCAGGG + Intergenic
922466992 1:225851181-225851203 TGACATACAGGGGCTCAGCATGG - Intronic
922731369 1:227950210-227950232 CGACATCCATGAACTCGGGAAGG + Intergenic
923914971 1:238491893-238491915 CCACATCCATGGGCTCTGCAAGG + Intergenic
924052830 1:240093793-240093815 CGCCCTCCCTGGGCTCTGGAAGG + Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1065383165 10:25110124-25110146 AGCCATCCATGGGCTGAGCATGG + Intergenic
1065628334 10:27653616-27653638 CCACAACCAGGGACTCTGCAAGG - Intergenic
1071526267 10:86361282-86361304 AGGCATCCAAGGGCTATGCAAGG + Intronic
1072922920 10:99591809-99591831 TGACATTTATTGGCTCTGCATGG + Intergenic
1075327080 10:121542442-121542464 CCAGATCCATTGGTTCTGCAGGG - Intronic
1076699037 10:132260699-132260721 TGGCATCCATGAGCACTGCATGG - Intronic
1076747876 10:132523383-132523405 GGCCATCCCTGGGCTCTGCTCGG + Intergenic
1077563511 11:3281276-3281298 CCCCATCAATGGGCTCTGGACGG - Intergenic
1077842939 11:5994602-5994624 CGAAATCCATGGGCTCCACAAGG - Intergenic
1077888957 11:6405209-6405231 TGACAGCTATAGGCTCTGCAGGG - Intronic
1080430249 11:32191485-32191507 CAGCAGCCATGGGGTCTGCAAGG - Intergenic
1080641699 11:34162261-34162283 CGACATCCCTGGGCTGTGACTGG + Intronic
1081367217 11:42250322-42250344 TGACTTCTATGTGCTCTGCACGG - Intergenic
1085445706 11:76599347-76599369 CCACATCCCTGGGGTCTGCTGGG - Intergenic
1089065427 11:115659095-115659117 CGACACCCACGCGCTCCGCAAGG + Intergenic
1090829513 11:130411227-130411249 CCACCTAAATGGGCTCTGCAAGG - Intronic
1092196527 12:6552906-6552928 CGATATCCATGTGTTCTGCATGG + Intronic
1093442816 12:19219166-19219188 TCACATACATGGGCTCTGCAAGG + Intronic
1096634710 12:52950789-52950811 CGACATCCATGGGCTCCGCAAGG + Exonic
1097950237 12:65419459-65419481 CGACATCTATGGGCTCTGCAAGG - Intronic
1101468988 12:104977479-104977501 TGACATCCATGGGCTCCGCAAGG - Intergenic
1102145148 12:110649683-110649705 CCACATCCCAGGGCTCTGCCAGG - Intronic
1104634179 12:130427405-130427427 CCGCATTCATGTGCTCTGCAGGG - Intronic
1104764978 12:131324236-131324258 CGACATGCAGGGGCCCTACAGGG - Intergenic
1111581683 13:90230930-90230952 TGACATCCATGGGCTCTGCAAGG + Intergenic
1113100937 13:106717220-106717242 TTATATCCATGGGTTCTGCAAGG + Intergenic
1114412263 14:22512212-22512234 CCACATCCATGGACTGTGGAAGG + Intergenic
1118966850 14:70595092-70595114 CAACATCCATGGGCTCTGCAAGG + Intronic
1119407150 14:74406035-74406057 CCACAGCCCTGGGCTCTGGATGG + Exonic
1127366858 15:58299413-58299435 TCACAGCCATGGGCTCTGAAGGG + Intronic
1130443622 15:83978680-83978702 CGGAATTCATGGGCTCTGCCAGG - Intronic
1131003908 15:88960291-88960313 TGACATCCATGAGATCTGCGAGG + Intergenic
1132321473 15:100928786-100928808 CCACATCCAGGGGCTTTGAAAGG - Intronic
1132508174 16:322962-322984 TGGCATCCATGGCCTCTGCCAGG - Intronic
1136019218 16:27429425-27429447 CTACATCAATAGGCTCAGCAAGG + Intronic
1136597322 16:31260290-31260312 CCACATTCATGGACTGTGCAAGG + Intronic
1140181962 16:72729154-72729176 TGACATCCATGGGCTCTGCAAGG + Intergenic
1142343977 16:89542234-89542256 CCACAGCCCTGGCCTCTGCAAGG + Intronic
1144103209 17:11962211-11962233 CTACATCCATGGCCTCTTCATGG + Exonic
1144625764 17:16843759-16843781 CGACATCAATGGCCCGTGCAGGG - Intergenic
1144880668 17:18428961-18428983 CGACATCAATGGCCCGTGCAGGG + Intergenic
1145871427 17:28276782-28276804 TGACATCCATGGGCTCCACAAGG - Intergenic
1147573248 17:41584352-41584374 CGACATCAATGGCCTGCGCAGGG - Exonic
1147579918 17:41622450-41622472 CGACATCAATGGCCTGCGCAGGG - Exonic
1147646676 17:42038380-42038402 GGAAACCCATGGGCTCTGAAGGG + Intronic
1148163039 17:45462495-45462517 AGACATCCATCGCCTCTGCCTGG + Intronic
1149936340 17:60810705-60810727 GGACATCCATGGGCTCTGCAAGG + Intronic
1150394268 17:64809150-64809172 AGACATCCATCGCCTCTGCCTGG + Intergenic
1153851930 18:9102875-9102897 GGAGAGCCCTGGGCTCTGCACGG + Intronic
1153907865 18:9678975-9678997 TGACATCCATGGGCTCCGCAAGG - Intergenic
1153962033 18:10148049-10148071 CCACAACACTGGGCTCTGCAGGG - Intergenic
1156838667 18:41585667-41585689 GGACACCTATTGGCTCTGCATGG + Intergenic
1157311407 18:46555973-46555995 GGACATCCATAAGCTATGCATGG + Intronic
1160228959 18:77032141-77032163 CAAATTCCATGGTCTCTGCAGGG - Intronic
1160432362 18:78820350-78820372 CCACAGCGATGGCCTCTGCAAGG + Intergenic
1160619679 18:80162015-80162037 AGGCAGCCATGGGCTCTGCTGGG - Intronic
1160982487 19:1822764-1822786 TGGGATCCATGGGATCTGCAGGG + Intronic
1162550780 19:11357198-11357220 CTTCCTCCATGGCCTCTGCAGGG - Intronic
1165728648 19:38130249-38130271 TGACTGCCATGGTCTCTGCAAGG + Intronic
1166295657 19:41888064-41888086 CCATCTCCCTGGGCTCTGCAGGG - Exonic
925031257 2:651421-651443 CCTCATGCATGGGCTCTGCATGG + Intergenic
925152629 2:1625612-1625634 CCACATTCCTGGCCTCTGCAAGG + Intergenic
925386440 2:3465050-3465072 CGACATTCACGCACTCTGCAAGG + Intronic
926712062 2:15889773-15889795 TGACATCCATAGCCCCTGCAGGG - Intergenic
928495097 2:31823334-31823356 CGACATCCATGGGCTCTGCGAGG - Intergenic
931791394 2:65667004-65667026 CGACATCCATGGGCTCCGCAAGG + Intergenic
932121284 2:69102947-69102969 AGAAACCCATGGACTCTGCAAGG - Intronic
932743148 2:74307453-74307475 CGACATCCGTGGGCTCCACAAGG - Intronic
936282062 2:111150627-111150649 AGACAGCAATGGGCTCTGCAAGG - Intronic
937976032 2:127582566-127582588 CCAGATCCGTGTGCTCTGCATGG + Intronic
938305577 2:130252162-130252184 CGCCATCCCTGGGCTCTGGGAGG - Intergenic
938595252 2:132782518-132782540 AGTCCTCCCTGGGCTCTGCAGGG + Exonic
942971373 2:181961917-181961939 TGACATCCATGGGCTCCACAAGG - Intronic
943548666 2:189311977-189311999 TGACATCCATGGGCTCCACAAGG - Intergenic
944855728 2:203765025-203765047 CGACATCCATGGGCTCCACAAGG - Intergenic
944873289 2:203935433-203935455 CCACAGCCAAGGGGTCTGCAAGG - Intergenic
945528987 2:210926486-210926508 CTACAACCCTAGGCTCTGCAGGG - Intergenic
948279389 2:236734904-236734926 AGACATCCATGGGAAATGCATGG - Intergenic
948371239 2:237490240-237490262 CGACCTCCATGGGCTCAGGGAGG - Intronic
948824967 2:240569593-240569615 AGACACACATAGGCTCTGCAGGG + Intronic
1171140087 20:22733528-22733550 CTACCTCCATGGGCTCTGCAAGG - Intergenic
1171395543 20:24830541-24830563 TGACTTCCATAGGCTCTACATGG - Intergenic
1172992990 20:39049800-39049822 CGACAACCAGGAGCTCTGAAGGG + Intergenic
1174349582 20:49957282-49957304 CGACATCCATGGGCTCTGCAAGG + Intergenic
1174408137 20:50316234-50316256 AGGCATCCATGGGCACTGGATGG - Intergenic
1174454887 20:50641958-50641980 ACACATCCAAGGGCTCTGCAGGG - Intronic
1174471915 20:50767772-50767794 ACACATCCAAGGGCTCTGCAGGG + Intergenic
1176145522 20:63563697-63563719 GGACATCGATGGGCTCTGCCAGG - Exonic
1179960730 21:44765863-44765885 CAACATGCATGGCCACTGCAGGG + Intergenic
1180887577 22:19258061-19258083 CGACATCCATGGGCTCTGCAAGG + Intronic
1181235509 22:21445798-21445820 CCAGATCCATGGGCTCATCAGGG - Exonic
1182924416 22:34109063-34109085 CAATATCCATGTGCTCTTCAGGG - Intergenic
1184448344 22:44567499-44567521 CAACATCCATGGACTCTGTAAGG + Intergenic
1184459211 22:44627736-44627758 GCACATGCATGGGCTCTGCGGGG - Intergenic
950494202 3:13324067-13324089 CCACATCCCTGGGAGCTGCAGGG - Intronic
951063197 3:18234453-18234475 AGACATCCAAAGTCTCTGCACGG - Intronic
951095478 3:18624876-18624898 CCACATCCATGGGGCTTGCAAGG - Intergenic
951361938 3:21735709-21735731 CGACATCTCTGGGAACTGCAAGG + Intronic
952319138 3:32259477-32259499 TGACATTCATGGGCTCTTCAAGG + Intronic
953884698 3:46708623-46708645 GGACATCCCTGGGCTCTCCCTGG - Intronic
956275715 3:67498971-67498993 TCACATACATGGGTTCTGCAAGG + Intronic
963089660 3:141471356-141471378 CGACATCCATGAACTCCCCAAGG - Intergenic
964137550 3:153361955-153361977 CCACATCCATGTCCCCTGCATGG + Intergenic
965544711 3:169903696-169903718 CAACATCCGTGGGCTCTGCAAGG - Intergenic
967594881 3:191317089-191317111 CCACCCCCATGGGCTCTGCACGG - Intronic
975800251 4:78054038-78054060 TGACACCCATGGCTTCTGCATGG - Intergenic
979050253 4:115921228-115921250 CAACATACATGGGCTCCGCAAGG + Intergenic
981217800 4:142191590-142191612 TTTCAACCATGGGCTCTGCAGGG - Intronic
981411937 4:144442375-144442397 GGGCAGCCATGGGCTCTGGAAGG + Intergenic
981422961 4:144572235-144572257 TCTCATCCATGGGCTCTACAAGG + Intergenic
989012213 5:36885742-36885764 CGACATCCGTGGGCTCTGCAAGG + Intronic
995215342 5:109588844-109588866 CGACATCCGTGGGCTCCACAAGG + Intergenic
1002814698 6:668940-668962 CCATATCCATGGGTTCTGCATGG - Intronic
1003420716 6:5956155-5956177 CGACATCCATGGGAGGTGAATGG + Intergenic
1003997127 6:11553155-11553177 TCACATACATGGGTTCTGCAGGG - Intronic
1004843458 6:19613270-19613292 CGACATCTATGGGCTCCACAAGG + Intergenic
1005761219 6:28969861-28969883 CGACATCCATGGGTTCCGCAAGG - Intergenic
1006316754 6:33296078-33296100 GGACATCCGTGGGGTCAGCAGGG + Exonic
1006465294 6:34190317-34190339 CGACATCTGTAGGCTCTGCTAGG + Intergenic
1011242597 6:85288259-85288281 CGACATCCGTGAGCTCCGCAAGG + Intergenic
1012168770 6:95991602-95991624 CCACATTCATGGGCTCAGGAAGG + Intergenic
1014009247 6:116458048-116458070 CGACATCCATGGGGTCCACAAGG - Intergenic
1015512836 6:134056280-134056302 CCACATCAATGTGCACTGCAGGG - Intergenic
1017945832 6:159095643-159095665 CAACACCCAAGGGCACTGCAAGG - Intergenic
1018173247 6:161158626-161158648 CAACGTCCAGGGTCTCTGCAAGG - Intronic
1018866317 6:167749107-167749129 CAACTTCCATGGGCACAGCAAGG + Intergenic
1020444332 7:8253717-8253739 ATACATACATGGGTTCTGCAGGG + Intronic
1028540898 7:91941087-91941109 CGTCCTCCATGGCCTCTGCAAGG - Exonic
1028898034 7:96063944-96063966 CGACATCCATGGGTCCTTCAAGG - Intronic
1037844889 8:22274549-22274571 AGACATCCAAGGGCTCTGCATGG - Intergenic
1038416188 8:27397647-27397669 CCACCACCATGGGCTCTGCAGGG - Exonic
1039388683 8:37159421-37159443 TAACATCCATGTGCACTGCAAGG + Intergenic
1039866768 8:41511776-41511798 CAACATCCATGGGCTCTGCAAGG + Intergenic
1046013309 8:108576183-108576205 CAACATTCATGGACTTTGCATGG + Intergenic
1048914852 8:139172772-139172794 ATACATACATGGGTTCTGCAGGG - Intergenic
1049441293 8:142610941-142610963 CTACACCCATGGGGTCTCCAGGG + Intergenic
1049586152 8:143433270-143433292 TTTCATCCATGGGCTCTGTAAGG + Intergenic
1050421455 9:5469774-5469796 GGAGACCCATGGGCTCTCCAGGG + Exonic
1052613002 9:30800191-30800213 CGACATCCATGGGCTCTGCAAGG - Intergenic
1053479301 9:38404116-38404138 TGAGAGCCCTGGGCTCTGCATGG + Intergenic
1055370207 9:75590398-75590420 CCACTTCCATTGGCTCTCCAGGG - Intergenic
1055708858 9:79037137-79037159 AGACATCCATGGGCTCCACAAGG - Intergenic
1057821292 9:98333093-98333115 TGGCTTCCGTGGGCTCTGCAAGG + Intronic
1058424434 9:104864267-104864289 TGACATCCCTGGGCTCTTCCTGG - Intronic
1059325463 9:113501582-113501604 CCGCTTCAATGGGCTCTGCAAGG + Intronic
1060348605 9:122838083-122838105 TGACATCCATGGGCTCCACAAGG + Intergenic
1061589696 9:131590428-131590450 CTGCCTCCCTGGGCTCTGCAAGG + Intronic
1061841677 9:133362128-133362150 TCTCATCCATTGGCTCTGCAGGG - Exonic
1187171025 X:16852260-16852282 CGACTTTCAAGTGCTCTGCAAGG + Intronic
1193041096 X:77004613-77004635 CCACATCCATGGCCCATGCAGGG + Intergenic
1194254928 X:91623984-91624006 TGACATGCTTGGGCTCTGCAGGG + Intergenic
1194321983 X:92460203-92460225 CGACATCCATGGGCTCCGCAAGG + Intronic
1195968889 X:110453439-110453461 CAACAGCCATGGTCTCTGGAGGG + Exonic
1200085881 X:153604788-153604810 CAACATCCATGGGCTTTGCAAGG - Intergenic
1200238933 X:154483603-154483625 GGACACACATGGGCTATGCAAGG - Intergenic
1200573712 Y:4863587-4863609 TGACATGCTTGGGCTCTGCAGGG + Intergenic
1200630150 Y:5573680-5573702 CGACATCCATGGGCTCCGCAAGG + Intronic