ID: 1180888617

View in Genome Browser
Species Human (GRCh38)
Location 22:19268202-19268224
Sequence CTCCAGAGGATGCAGCAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180888608_1180888617 9 Left 1180888608 22:19268170-19268192 CCTTTTTGCCCTTCTGTCACAGT No data
Right 1180888617 22:19268202-19268224 CTCCAGAGGATGCAGCAACAGGG No data
1180888609_1180888617 1 Left 1180888609 22:19268178-19268200 CCCTTCTGTCACAGTGTTCCTCC No data
Right 1180888617 22:19268202-19268224 CTCCAGAGGATGCAGCAACAGGG No data
1180888610_1180888617 0 Left 1180888610 22:19268179-19268201 CCTTCTGTCACAGTGTTCCTCCC No data
Right 1180888617 22:19268202-19268224 CTCCAGAGGATGCAGCAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180888617 Original CRISPR CTCCAGAGGATGCAGCAACA GGG Intronic