ID: 1180894164

View in Genome Browser
Species Human (GRCh38)
Location 22:19316210-19316232
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180894164_1180894169 17 Left 1180894164 22:19316210-19316232 CCAGCACTCCCTCCACATAAGGA No data
Right 1180894169 22:19316250-19316272 CCTTATTTTCCTTTCCCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180894164 Original CRISPR TCCTTATGTGGAGGGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr