ID: 1180898076

View in Genome Browser
Species Human (GRCh38)
Location 22:19351887-19351909
Sequence AAGAGGGGCAACTGAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 288}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180898066_1180898076 16 Left 1180898066 22:19351848-19351870 CCAGCCCGCAGGAGGTAAGAGAT 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1180898076 22:19351887-19351909 AAGAGGGGCAACTGAGTGGAGGG 0: 1
1: 0
2: 2
3: 34
4: 288
1180898068_1180898076 12 Left 1180898068 22:19351852-19351874 CCCGCAGGAGGTAAGAGATGGCA 0: 1
1: 0
2: 0
3: 13
4: 229
Right 1180898076 22:19351887-19351909 AAGAGGGGCAACTGAGTGGAGGG 0: 1
1: 0
2: 2
3: 34
4: 288
1180898069_1180898076 11 Left 1180898069 22:19351853-19351875 CCGCAGGAGGTAAGAGATGGCAA 0: 1
1: 0
2: 1
3: 14
4: 207
Right 1180898076 22:19351887-19351909 AAGAGGGGCAACTGAGTGGAGGG 0: 1
1: 0
2: 2
3: 34
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180898076 Original CRISPR AAGAGGGGCAACTGAGTGGA GGG Intronic
900802764 1:4747535-4747557 AAGAGGGACAAGTGGGAGGATGG - Intronic
901977183 1:13004426-13004448 AAAAGAGGCAACAGAGGGGAGGG + Intronic
902004903 1:13224508-13224530 AAAAGAGGCAACAGAGGGGAGGG - Intergenic
902024122 1:13370244-13370266 AAAAGAGGCAACAGAGGGGAGGG - Intronic
902528892 1:17077659-17077681 ATGAGTGGCCACTGAGTGGAGGG + Intronic
906371868 1:45260825-45260847 AATAGGGGAAACTGAGTGAGGGG + Intronic
906729559 1:48069580-48069602 AAGAGGGGAAATTGAGTTCAAGG - Intergenic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907470870 1:54672676-54672698 ATGAGGAGCAAATGAGAGGATGG - Intronic
907505008 1:54911756-54911778 AAGAGGGGGAACTGAGAGACAGG - Intergenic
907519485 1:55013892-55013914 ATGAAGGGCACCTGGGTGGAGGG - Intergenic
907595282 1:55713877-55713899 AAAAGGGACAATTGAGTGGATGG - Intergenic
908677883 1:66626571-66626593 AAGATGGTCAAATAAGTGGAAGG - Intronic
910510842 1:88002193-88002215 AAGATGGGCAGATGAGTGAATGG + Intergenic
910648684 1:89540728-89540750 AACACTGGCAACTGTGTGGAGGG + Intronic
912776361 1:112508670-112508692 AAGTGGGGCTGCTGAGTGAAGGG + Intronic
912878892 1:113390177-113390199 AGGAGGGGCAGGGGAGTGGAAGG - Intergenic
918679631 1:187335978-187336000 AATAGGGGAAATTGAGTGTAGGG + Intergenic
920590496 1:207214057-207214079 AAGAGAGGAAACTGGGTGAAGGG - Intergenic
920851326 1:209630042-209630064 AAGTGGGGAAACTGAGGGCAAGG + Intronic
923487875 1:234453254-234453276 AACAGGGGAAACTGTGTGTAGGG + Intronic
924278784 1:242415223-242415245 AAGAGGGGTTACTGAGTGAGAGG - Intronic
1063610399 10:7557264-7557286 AAGAGGGGATCCAGAGTGGAGGG + Intergenic
1064533179 10:16331186-16331208 GATTGGGGAAACTGAGTGGAGGG - Intergenic
1064716755 10:18184417-18184439 AATAGGGGAAACTGAGTCTAGGG - Intronic
1064977062 10:21127744-21127766 AAAAGGGGGAAAGGAGTGGAAGG + Intronic
1065883733 10:30059209-30059231 GAGCGGGGCACCTGAGGGGAGGG + Intronic
1066137070 10:32459251-32459273 AAGAAAAGCAACTAAGTGGAGGG - Intronic
1066723382 10:38363871-38363893 AATAGGGGAAACTGGGTGTAGGG - Intergenic
1067352570 10:45489932-45489954 AGGAGGAGAAACTGAGTTGAAGG - Intronic
1067765194 10:49080602-49080624 GAGAGGGGCAGGTGTGTGGAAGG + Intronic
1068189363 10:53630370-53630392 TCCAGGGGCAACTGAGTAGACGG - Intergenic
1068904028 10:62302474-62302496 AGGAGGGGGAACTGAGTAAAGGG - Intergenic
1072018952 10:91379779-91379801 AGCAGGGGCAAGTGAGAGGAGGG + Intergenic
1073263693 10:102209926-102209948 AAGAGGGGCATCTGTGGAGAGGG - Intergenic
1073752037 10:106539848-106539870 AAGAAGGGCAAATCACTGGAGGG - Intergenic
1074829279 10:117237416-117237438 AAAAGGTGCAAGTGAGTGGAGGG + Intergenic
1076679171 10:132162919-132162941 AAGTGGGGAAGCTGAGTGGGAGG - Intronic
1076912990 10:133401695-133401717 CAGCGGGGACACTGAGTGGAGGG - Intronic
1078593673 11:12668171-12668193 GAGAGGAGCAAGTGAGTGCATGG - Intergenic
1080657425 11:34268836-34268858 AAGAGGGGCATCTGAATACAGGG - Intronic
1080670694 11:34373840-34373862 AATAGGGGAAACTGGGTGTAGGG - Intergenic
1081389067 11:42507590-42507612 AAGAGGGTCTAGTGTGTGGAGGG + Intergenic
1082883985 11:58065112-58065134 CAGAGGGGCTATGGAGTGGACGG + Intronic
1083166669 11:60892710-60892732 AAGAGGGGCAAGAGACAGGAGGG - Intronic
1083886780 11:65576936-65576958 AAAAGGGGAAACTGAGTGCTGGG + Intronic
1084762678 11:71283926-71283948 AACAGGGGCAGCGGAATGGAAGG + Intergenic
1086096528 11:83055440-83055462 GAGAAGGGCAACTCAGGGGAAGG - Intronic
1086245172 11:84743137-84743159 AATAGGGGAAACTGGGTGGATGG - Intronic
1087619763 11:100528256-100528278 AAGAGTGACATCGGAGTGGAGGG + Intergenic
1088736482 11:112731959-112731981 AAGAGTGGCTATTGAGGGGATGG + Intergenic
1089895552 11:121927004-121927026 AAGAGGGGCAAGAGACAGGAGGG + Intergenic
1090190018 11:124761395-124761417 AAGAGGGGAAATTGGGAGGAGGG - Intronic
1090856903 11:130617758-130617780 AAGAGGGGCAGAGGAGTCGAGGG + Intergenic
1090984645 11:131755336-131755358 AAGACTGGCAAGGGAGTGGAAGG + Intronic
1091192684 11:133707704-133707726 AAGAAGGGGAAGTGAATGGAAGG + Intergenic
1091931842 12:4402704-4402726 AAGAGGGGCAGCAGAGTCCAGGG + Intergenic
1092073386 12:5652323-5652345 AATAGGGGAAACTGGGTGCAGGG - Intronic
1092204138 12:6605624-6605646 AAGAGGGGCAAAAGAAGGGAGGG - Intronic
1092503286 12:9068597-9068619 AAGAGGGGCATCAGACTTGATGG + Intronic
1092871018 12:12805837-12805859 AGGAGGGGCAAATATGTGGAAGG - Intronic
1094025919 12:25959229-25959251 GAGAGGGGCAACCGGGCGGAGGG - Intronic
1096916978 12:55044002-55044024 AAAAGGGGAAACTTAGTGAAGGG + Intergenic
1096978048 12:55711121-55711143 ATTAGGGGAAACTGAGTGAAAGG + Intronic
1099325090 12:81204637-81204659 ATAAGGGGCAACTTAGTGAAGGG + Intronic
1099457741 12:82884677-82884699 AATAGGGGAAACTGGGTGTATGG - Intronic
1102101092 12:110279815-110279837 AAGAGGGGCACGTGAGTGCACGG - Intergenic
1102986959 12:117286037-117286059 AAGAGGGGAAGGGGAGTGGATGG - Intronic
1104634379 12:130428350-130428372 AAAAGGGGCTACTGAGCGGGTGG + Intronic
1107954746 13:45500619-45500641 AATAGGAGCAACTGGGTGCAGGG - Intronic
1111539899 13:89656288-89656310 AAGAATGGGAACTGAGTGAAGGG - Intergenic
1114417003 14:22551642-22551664 AAGAGGGGCAATGCAGAGGAAGG - Intergenic
1117667474 14:58071994-58072016 AACAAGGGAAACTGAGTTGAGGG - Intronic
1118231772 14:63958131-63958153 AATAGGGGAAACTGGGTGCAGGG - Intronic
1118239878 14:64045903-64045925 AATAGGGGAAACTGGGTGCAGGG - Intronic
1120961266 14:90127144-90127166 AACAGGGCAAACTGAGTGCAGGG + Intronic
1121227924 14:92335193-92335215 AATAGGGGAAACTGTGAGGATGG - Intronic
1121826112 14:97010921-97010943 AACTTGGGCAACTGAGTGAATGG + Intergenic
1122436175 14:101701620-101701642 AATAGGGGAAACTGAATGAAGGG + Intergenic
1122506269 14:102233775-102233797 AAGAGGGGCTGCAGACTGGAAGG + Exonic
1124116073 15:26843972-26843994 AACAGGGGAAACTGTTTGGAGGG + Intronic
1125171187 15:36768406-36768428 AAGAAGGCCAGCTGAGTGGAAGG - Intronic
1125688653 15:41578914-41578936 AAGAGGGGCACCTGATAGGCTGG - Exonic
1126240236 15:46433463-46433485 AGCAGGGGCAACTGGGTGGAGGG + Intergenic
1126382036 15:48058727-48058749 AAGGAGGGCAACTAAGTGCAAGG + Intergenic
1127201851 15:56662915-56662937 AAGAAGGTAAACTGAGAGGAAGG + Intronic
1128149505 15:65354406-65354428 AAAAGGGGCAACAGAGTTGTAGG - Intronic
1128198649 15:65784468-65784490 AATAGGGGAAACTGGGTGCAAGG + Intronic
1128511912 15:68318669-68318691 AGGAGGGGAAGCTGAGTGGAGGG - Intronic
1128580845 15:68808587-68808609 AAGTGGTGTAACTGAATGGACGG - Intronic
1128713084 15:69886570-69886592 AGGAGGGATGACTGAGTGGATGG - Intergenic
1128980424 15:72181353-72181375 AAGTGGGGCAGGGGAGTGGAGGG + Intronic
1130173653 15:81544990-81545012 AATAGGGGAAACTGAGTAAATGG - Intergenic
1130246683 15:82257652-82257674 AATAGGGGAAACTGTGTGGGTGG - Intronic
1131937252 15:97520464-97520486 AAGAGGCCCAACTGACTGGTAGG - Intergenic
1133230895 16:4366037-4366059 ACGTGGGGTAACTGAGTAGAGGG - Intronic
1133837101 16:9377192-9377214 CAGAGAGGCAGCAGAGTGGATGG - Intergenic
1133866238 16:9646196-9646218 AATAAAAGCAACTGAGTGGATGG - Intergenic
1134410573 16:14000373-14000395 AAGAGGGGCTACGGGATGGAGGG - Intergenic
1134637001 16:15800169-15800191 TGGATGGGCAAGTGAGTGGAAGG + Intronic
1135637431 16:24090519-24090541 AAGAGGGGCAAGGGAGTTGAGGG + Intronic
1136088713 16:27903388-27903410 AGCAGGGGCAACTGTCTGGATGG + Intronic
1136465878 16:30443344-30443366 AAGAGGGGTAACTGACTTAAAGG - Intergenic
1137055170 16:35742273-35742295 AGGAGGGGCTACAAAGTGGAAGG + Intergenic
1137287283 16:47026910-47026932 AAGAGGCACAACTGAGTTGGAGG - Intergenic
1137691982 16:50434853-50434875 AACAGGGGAAACTGTGTGTAGGG + Intergenic
1138263656 16:55643944-55643966 AAGTGGGGCAAAGAAGTGGAGGG + Intergenic
1143595167 17:7909595-7909617 AAGAGGCCCCACTGTGTGGAGGG - Intronic
1145940348 17:28740381-28740403 AGGAGGGCCCACTGAGGGGAGGG - Intronic
1148512511 17:48184532-48184554 GAGAGTGGCAACAGAGGGGAGGG + Intronic
1149792118 17:59488394-59488416 AAGAGGGGCAAAGGAATGAATGG + Intergenic
1149974682 17:61253627-61253649 AGGAGGGGCAGCTGAGTAGAGGG + Intronic
1150075863 17:62191658-62191680 GAGAGGGGGAAGTGACTGGAGGG - Intergenic
1150482556 17:65521783-65521805 CAGAGAGACAACTGTGTGGAGGG + Intergenic
1151284479 17:73100039-73100061 AAGAGTGGGAACTGTTTGGAGGG - Intergenic
1151615260 17:75205905-75205927 AAAAGTGGCAACTGAGTCGAGGG - Intronic
1151643780 17:75415733-75415755 GAGAGGGGCAAGTGAGTAGATGG - Intergenic
1151667968 17:75556461-75556483 GAGAGGGGAAACTGAGTAAAGGG - Intronic
1151842268 17:76626984-76627006 AAGAGGGGCAAGAGAGGGGCTGG + Intronic
1151973242 17:77469903-77469925 TAGATGGGTAAATGAGTGGATGG - Intronic
1152170458 17:78743281-78743303 AGGAGGGGCTGGTGAGTGGACGG - Intronic
1152340977 17:79724532-79724554 AACAGGGGAAACTGGGTGCAAGG + Intergenic
1152983375 18:300002-300024 AATAGGGAAAACTGAGTGCAGGG - Intergenic
1154334315 18:13453768-13453790 ATGAGGGGCAACAGAGGGAAGGG - Intronic
1155417608 18:25616788-25616810 GAGAGAGTCAGCTGAGTGGAAGG + Intergenic
1156086614 18:33413718-33413740 AGGAGAGGCAACTGAGAGGTTGG + Intronic
1156100362 18:33586592-33586614 TAAAGGGGCAACTGAGAGAAGGG - Intronic
1158875709 18:61732844-61732866 AAGATGGGCATCTGAGTGCTAGG - Intergenic
1159954946 18:74512675-74512697 CAGAGGGACAAGTGAGTGGAAGG - Intronic
1160791222 19:924714-924736 AGGAGGTGCAACTAGGTGGAAGG + Intergenic
1160992437 19:1865208-1865230 GAGAGGGGCAAGTGTGTGCAGGG - Intergenic
1161113824 19:2485619-2485641 AAGAGAGGCATCTGTGTGTATGG + Intergenic
1162796509 19:13090134-13090156 CAGAGGGGCATCTGAGCTGAAGG - Intronic
1163456769 19:17411336-17411358 AAGAGGGGAAATTGGGTGTAGGG - Intronic
1165168279 19:33872385-33872407 TGGATGGGCAAATGAGTGGATGG - Intergenic
1165168328 19:33872562-33872584 TGGATGGGCAAATGAGTGGATGG - Intergenic
1166848166 19:45743143-45743165 AAAGGGAGCAACTGAGTGGATGG - Intronic
1167607022 19:50486892-50486914 AACAGGGGATACTGGGTGGAAGG - Exonic
1168277800 19:55286768-55286790 GAGAGGGGCACCTGGCTGGATGG + Intronic
924990005 2:306108-306130 AAGAGAGTAAACAGAGTGGAAGG - Intergenic
926088389 2:10034214-10034236 ATTAGGGGGAACTGCGTGGAGGG - Intergenic
926326486 2:11788623-11788645 AAGAGGGGCAACCACGTGCAAGG - Intronic
926966926 2:18425330-18425352 ACCAGGGGGAACTGAGTGGAGGG - Intergenic
927735359 2:25515899-25515921 AACAGGGGAAACTAAGTGCAGGG + Intronic
928331456 2:30360848-30360870 AAGAGGGGCTCATGGGTGGAGGG + Intergenic
928466717 2:31529049-31529071 AACAGAGGCAACTGAGGTGACGG - Intronic
928781534 2:34827906-34827928 AAGATGGTCAATTGAGAGGAAGG - Intergenic
929948832 2:46390648-46390670 AATAGAGGAAACTGAGTGCAGGG - Intergenic
931510415 2:62985708-62985730 AAGAGGTACAATTGAGGGGAGGG - Intronic
931686395 2:64797584-64797606 AGGAGTGGTAACTGAGTGAATGG + Intergenic
935175828 2:100648002-100648024 GAGAGAGGCAACTGAGTGGTTGG + Intergenic
935539031 2:104327505-104327527 AAGAGGGGAATCTGAGTGTAGGG + Intergenic
936501525 2:113070502-113070524 AGGTGGGGCAACAAAGTGGAGGG - Intronic
937256253 2:120557909-120557931 CAGTGGGGCAAGTGAGAGGAGGG - Intergenic
938016986 2:127875379-127875401 AAGAAGGGCAAGTGGGGGGAGGG + Intronic
938069155 2:128299443-128299465 ATGTGGGGAAACTGAGTGGATGG + Intronic
940781073 2:157934197-157934219 AACTTGGGTAACTGAGTGGAAGG + Intronic
940938360 2:159526043-159526065 AAGAGTGACAAATGAGGGGATGG + Intronic
941778833 2:169422554-169422576 AAAAGGGGAAAATGAGTGGGAGG - Intergenic
942546756 2:177073421-177073443 AAGAGGGCCAAGTGAAGGGAGGG - Intergenic
945262419 2:207856001-207856023 AATAGGGGAAACTGAGTGTGTGG + Intronic
945930771 2:215852808-215852830 AAGAAGAGCAACTGAGGGAATGG - Intergenic
946239760 2:218346310-218346332 ATGAGGGGAAACTGAGGGCAGGG - Exonic
946266558 2:218548163-218548185 AAGTGGAAGAACTGAGTGGATGG - Intronic
946387913 2:219396818-219396840 ATCTGGGGAAACTGAGTGGAGGG + Intronic
947131579 2:226932608-226932630 GAGAGGGACAAGGGAGTGGAAGG - Intronic
1168924121 20:1565834-1565856 GTGAGGGCCAACTGAGTGGGTGG - Intronic
1168927959 20:1598511-1598533 ATCAGGGGCTACTGAGTGGGTGG - Intronic
1169629888 20:7618942-7618964 AATAGGGGAAACTGGGTGCAGGG + Intergenic
1169910446 20:10643837-10643859 AACAGCGGCACCTGTGTGGATGG - Exonic
1171802341 20:29635428-29635450 AAGAGTGGCAGCAGAGTTGATGG - Intergenic
1172215977 20:33236058-33236080 CAGAGGGGCCACAGAATGGATGG - Intronic
1174572434 20:51511615-51511637 TAAAGGAGCAACTGAGTGGATGG - Intronic
1174805996 20:53604949-53604971 CAAAGGGGCTACAGAGTGGAGGG + Intronic
1175765144 20:61587245-61587267 AAGGGGGGCCACTGAGTGACTGG + Intronic
1176732812 21:10517769-10517791 CAAAGGGGCTACAGAGTGGAGGG - Intergenic
1177395852 21:20534948-20534970 AATAGGGGAAACTGAGTGTGTGG + Intergenic
1177790118 21:25713893-25713915 GATAAGGGCAACTGAGAGGAAGG - Intronic
1178597053 21:33963583-33963605 AAAATGGGCAAGAGAGTGGAGGG - Intergenic
1180556056 22:16576063-16576085 AAGAGGGGAATGTGAGGGGAGGG + Intergenic
1180898076 22:19351887-19351909 AAGAGGGGCAACTGAGTGGAGGG + Intronic
1181629789 22:24144676-24144698 AGGAGGGGCAACAGAGTGCCAGG - Intronic
1182255427 22:29034232-29034254 AAGAGGGCCAACTGGGTGCCAGG - Intronic
1183247929 22:36708284-36708306 AAGATGGGCAACTGTGAGGCAGG + Intergenic
1184072120 22:42152837-42152859 AAGAGGGGCTTGTGAGTGGGCGG - Intergenic
1184909893 22:47524061-47524083 AAGAGGAGTAAATAAGTGGAAGG + Intergenic
1185017984 22:48356855-48356877 AAAAGGAGCAATGGAGTGGAAGG + Intergenic
951030031 3:17871172-17871194 AAGAGGGGAGACTGGGAGGAGGG - Intronic
952181014 3:30916756-30916778 AATAGGGGAAATTGAGGGGAGGG - Intergenic
952191839 3:31031070-31031092 AATAGGGGAAACTGTGTGCAGGG - Intergenic
952497842 3:33931650-33931672 CAGAGGGGGAATTGACTGGAAGG - Intergenic
952513077 3:34076464-34076486 GAGTGGGTGAACTGAGTGGAGGG + Intergenic
954258735 3:49423776-49423798 GAGAGGGGCAACTGGGAGAAAGG + Exonic
957191953 3:77021323-77021345 AAGAGGGGCAAGAGACAGGAGGG - Intronic
958681501 3:97337874-97337896 AAGACGAGCAACTCAGTGGGTGG + Intronic
962050672 3:131811468-131811490 AAGAAGGACAACTCAGTGAATGG + Intronic
964074806 3:152680800-152680822 AACAGGGGCTACTATGTGGATGG - Intergenic
966193707 3:177293765-177293787 AAGAAGGGCAACTGATTGGAAGG + Intergenic
966369803 3:179238048-179238070 AAGAGGGGAATGTGAGGGGAGGG + Exonic
966914603 3:184577865-184577887 AGAAGGGGCTGCTGAGTGGAGGG - Intronic
966969808 3:185033054-185033076 AATAGGGGCAACTGTGGGGGTGG - Intronic
968118169 3:196105579-196105601 AATAGGAGAAACTGAGTGTATGG + Intergenic
969075144 4:4572340-4572362 AAAAGGGGCAGCTCAGTGTAGGG - Intergenic
970032184 4:11688647-11688669 AACAGGGGATACTGAGGGGACGG + Intergenic
970733723 4:19140699-19140721 AAGAGGAGCAAGAGAGTGAAGGG + Intergenic
971406501 4:26325407-26325429 AAGAGAGGCAACAGAGTGGAGGG + Intronic
972833427 4:42840042-42840064 GAGAGGTAAAACTGAGTGGAAGG + Intergenic
974170624 4:58262004-58262026 AAGAGGGGAAAGTGAGTGTGAGG + Intergenic
974235988 4:59181482-59181504 AATAGGGGAAACTGGGTGCAGGG - Intergenic
975283090 4:72585961-72585983 AATAGGGGCAACTGGGTGTGGGG - Intergenic
975755224 4:77565097-77565119 ATGAGAGGGAACTGAATGGAGGG + Intronic
976840308 4:89425151-89425173 AAGAGGCACACCTGAGTGGGTGG - Intergenic
977032690 4:91906726-91906748 AAGAGGGGCTACAGTGTGGCAGG - Intergenic
981332910 4:143533285-143533307 AAGAGGGGATAGTGATTGGAAGG + Intronic
983144514 4:164197106-164197128 AAGAGGAGGACGTGAGTGGAGGG - Intronic
983781316 4:171673967-171673989 AAGAGGGTCAAGTGGGTGAAGGG + Intergenic
983825280 4:172250590-172250612 AAGAATGACAACTGAGTGAAGGG - Intronic
985635758 5:1034977-1034999 GGGAGGGACAAGTGAGTGGATGG + Intronic
985773915 5:1830705-1830727 AGGAGGGGGAAGTGAGAGGAGGG - Intergenic
985912921 5:2897210-2897232 AAGATGGGCCCCTGAGTGGCTGG - Intergenic
986190036 5:5487871-5487893 AAGACAGCCATCTGAGTGGATGG + Intronic
987825867 5:23029690-23029712 AAGAGGGGCAAGGGAGTTGAGGG - Intergenic
988438880 5:31209359-31209381 AAGAGAGGTTACTGATTGGAAGG - Intronic
988905570 5:35784919-35784941 AATAAGGGCACCTGAGTGGTTGG + Intronic
989265948 5:39474399-39474421 GAGAGGGGAAACTGAGTTTATGG + Intergenic
990406088 5:55492521-55492543 AGAAGAGGCAACTGAGTTGAAGG + Intronic
992270202 5:75055223-75055245 TAGAGGAGCAAGTGAGTGAATGG - Intergenic
993417293 5:87650972-87650994 AACAGGGGAAACTGAATGCAGGG - Intergenic
994759203 5:103832608-103832630 ATGAGGGACTACTGAGTTGAAGG + Intergenic
995305979 5:110650886-110650908 AATAGGAGAAACTGAGTGCAGGG + Intronic
995752070 5:115462475-115462497 GATAGGGGCAACAGAGGGGAGGG + Intergenic
995840662 5:116440508-116440530 AAGAGAGGCAGCTGAATGGTGGG - Intergenic
996199448 5:120652877-120652899 AATAGGGGAAACTGAGTGAAGGG + Intronic
998994483 5:147855474-147855496 GAGAGGGGCAACTTTGTGGGAGG + Intergenic
1000514649 5:162225191-162225213 AAGAGGGGAAACTGTGTTCAGGG + Intergenic
1002082546 5:176746072-176746094 CAGATGGGCAAGAGAGTGGAAGG + Intergenic
1002154936 5:177269771-177269793 AAGATGGGCAAAGGAGTGGATGG + Exonic
1002190603 5:177475513-177475535 AATAGGGAAAACTGAGTGCAGGG - Intergenic
1003864091 6:10347816-10347838 GAGAGGGGCAATGGAGTGAAGGG + Intergenic
1005149938 6:22737239-22737261 AAGAGGGGAAGCTGGCTGGATGG + Intergenic
1005928109 6:30461464-30461486 AAGAGGGTCACCTGGGTGGGTGG + Intergenic
1007909663 6:45500959-45500981 ATGAGCAGCAGCTGAGTGGAAGG + Intronic
1008413010 6:51205282-51205304 AAGAGGGGGGAGGGAGTGGAAGG - Intergenic
1010471505 6:76233759-76233781 AAGAGGGGATCCTCAGTGGAGGG - Intergenic
1010515903 6:76772282-76772304 AAGAAAGGCAACTAAGTGGATGG + Intergenic
1012278612 6:97302531-97302553 AATAGGGGAAACTGGGTGTAGGG - Intergenic
1013111437 6:107068345-107068367 AAGAGGGGCAAGAGAGTTGCTGG + Exonic
1014247271 6:119081850-119081872 AAGAGGAGCACATCAGTGGAGGG - Intronic
1014299115 6:119658535-119658557 AAGAAAGGCAACTTAGTGCAGGG + Intergenic
1014488449 6:122031338-122031360 ACTGGGGGAAACTGAGTGGAAGG - Intergenic
1015146962 6:129997756-129997778 AAGAAAGACAACTGGGTGGATGG + Intergenic
1015359687 6:132324824-132324846 AAGAAAGGAAACTGAGGGGAAGG - Intronic
1015940648 6:138448260-138448282 AAGAAGGCCAAATGAGTGCAGGG + Intronic
1017052372 6:150405600-150405622 AAGAATGACAACTGAGTGAATGG + Intronic
1017500880 6:155021694-155021716 AAATGAGGCAACTGAGGGGATGG - Intronic
1018358810 6:163045089-163045111 AAGATGGGCAACAGAGTTGCTGG - Intronic
1020811301 7:12853263-12853285 GAGAGGGGGAACTGAGAGGCAGG - Intergenic
1021228026 7:18051293-18051315 AAAAGGGGCAACAGAGTTGTTGG + Intergenic
1022687275 7:32608731-32608753 TAGAGGGACAACAGAGAGGAAGG + Intergenic
1023820940 7:43980220-43980242 AAGAGAGGCAGCTGAGGGGAGGG + Intergenic
1024349893 7:48352994-48353016 AAGAGGGGAAGCTCAGTGAAGGG + Intronic
1024526019 7:50350056-50350078 AAGAGGGGCAGCAGGGTGTAGGG + Intronic
1024527929 7:50364587-50364609 AAGAGGGTCAACTTAGAGGCAGG + Intronic
1025604027 7:63025927-63025949 AAAAGGGGAAACTGAGTGCAGGG - Intergenic
1026930834 7:74222087-74222109 AGGAAGGGCAACTGAGAGGCCGG + Intronic
1027328357 7:77065354-77065376 AAGAGAGGCAGCTGAGGGGAGGG - Intergenic
1028146205 7:87322719-87322741 AAGAGATGAAAATGAGTGGATGG - Intergenic
1028253324 7:88561117-88561139 AAGTAGAGGAACTGAGTGGATGG - Intergenic
1028769414 7:94599634-94599656 ATGATGGGCAACTGAGAGGTGGG + Intronic
1029103874 7:98158004-98158026 AACAGGGGAAACTGGGTGAAGGG + Intronic
1029336509 7:99904597-99904619 AATAGGGGAAACTGGGTGAAGGG + Intronic
1029368885 7:100134880-100134902 AAAAGGATCAACTGAGTGGTAGG - Intergenic
1029749214 7:102533660-102533682 AAGAGAGGCAGCTGAGGGGAGGG + Intergenic
1029767157 7:102632764-102632786 AAGAGAGGCAGCTGAGGGGAGGG + Intronic
1030326395 7:108223167-108223189 AACTGGGGCATCTGAGTTGATGG - Intronic
1032035793 7:128520336-128520358 CAGACGGGCAACTTGGTGGAGGG + Intergenic
1034415229 7:150961077-150961099 CAGAGGGGGAGCTGAGAGGAAGG - Intronic
1034758917 7:153652534-153652556 AACAGGGGAAGCTGAGTGAAGGG + Intergenic
1036203041 8:6785128-6785150 AAGAGGAACAAAGGAGTGGATGG - Intergenic
1036781151 8:11648730-11648752 AAAAGGGTAAACTGAGTGCAGGG + Intergenic
1037695136 8:21217018-21217040 ACCAGAGGCAACTGAGTGGAGGG - Intergenic
1037725058 8:21476482-21476504 AATAGGGGAAACTGAGTGAAGGG + Intergenic
1040514516 8:48123968-48123990 ATGAGAGGCAACAGAATGGAAGG - Intergenic
1040635046 8:49263471-49263493 AAGATGGGCATCTGTTTGGAAGG - Intergenic
1042266787 8:66916621-66916643 CTGAGGGGCAAAGGAGTGGAGGG + Intronic
1044682470 8:94795849-94795871 AAGAGAATCAACTGAATGGAAGG - Intergenic
1045826114 8:106400501-106400523 AAAAGAGGAAACTGATTGGAAGG - Intronic
1046278511 8:111993482-111993504 ATCAGGGGCACCTGTGTGGAAGG - Intergenic
1046619102 8:116509064-116509086 AAGAGGGTCAAGGGAGTTGAGGG + Intergenic
1047235523 8:123039019-123039041 CACAGGAGCAGCTGAGTGGATGG - Intronic
1049474768 8:142791736-142791758 AAGGTGGGCAGATGAGTGGATGG - Intergenic
1050070252 9:1803429-1803451 AATAGGGGAAATTGAGTGAAGGG + Intergenic
1050604421 9:7285834-7285856 AAGGCAGGAAACTGAGTGGATGG - Intergenic
1051461784 9:17327061-17327083 AATAGGGGAAACTGAGTGGGTGG + Intronic
1052755283 9:32534662-32534684 AAGAAGGGCAAGTGAGTTGGAGG + Intergenic
1053129926 9:35609095-35609117 ACCAAGGGCAGCTGAGTGGATGG - Exonic
1054717776 9:68574091-68574113 AAGAGAAGCAACTGGGAGGAGGG + Intergenic
1056002713 9:82233812-82233834 AAGAGAGGGAACTTAGAGGATGG + Intergenic
1056234553 9:84580644-84580666 AATAGGGGAAACTGGGTGTAGGG + Intergenic
1057192131 9:93094204-93094226 AAGGGTGGCGACGGAGTGGAAGG - Intergenic
1059437764 9:114286860-114286882 AAGATGGGAAACTGAGAGGAAGG - Intronic
1059536530 9:115086190-115086212 AACAGGGGCCTCTGTGTGGACGG - Exonic
1059710372 9:116862470-116862492 AAGAGGGTCACCTGCGGGGAGGG + Intronic
1061931033 9:133833322-133833344 AAGAGGGGGAGCTGCGTGTATGG - Intronic
1185874229 X:3688965-3688987 AATATGGGCACCTGGGTGGAAGG + Intronic
1187039404 X:15577866-15577888 AAGAGAGGTAACTGAATGAATGG - Intronic
1187792991 X:22971015-22971037 AAGAAGAGCCTCTGAGTGGAGGG + Intergenic
1188504528 X:30867348-30867370 AATAGGGGAAACTGAGTGCAGGG + Intronic
1188614949 X:32146378-32146400 GAGAGAAGTAACTGAGTGGATGG + Intronic
1190118284 X:47639697-47639719 AAGAGGAGCTACAGTGTGGAGGG - Intronic
1190623267 X:52310307-52310329 AATAGGGGAAATTGAGGGGAAGG + Intergenic
1190633374 X:52411108-52411130 AAGGTGGGCCACAGAGTGGAGGG - Intergenic
1190953829 X:55171993-55172015 AAGGAGGGCCACGGAGTGGAGGG + Intronic
1191896088 X:65994896-65994918 GAGAGGGGCCACTGAGTCTATGG - Intergenic
1194424050 X:93715277-93715299 AAGATGGGAAGGTGAGTGGATGG - Intergenic
1195768348 X:108320423-108320445 AAGAGGGGCAAGGGAGTCAAGGG + Intronic
1196030977 X:111095903-111095925 AAGAGGGGCACCTGACAGGATGG - Intronic
1196133065 X:112178498-112178520 ACTAGGGGAAACTGAGTGAAGGG + Intergenic
1196523010 X:116695782-116695804 AAGTTGGGCCACTGAGTGGCTGG - Intergenic
1196790410 X:119459340-119459362 AAGAGCAGCAAAGGAGTGGATGG + Intergenic
1198374009 X:136019682-136019704 AATAGGGGAAACTGAGTGCGGGG - Intronic
1198610945 X:138399832-138399854 AAGAAGGGAAACTGCATGGAAGG + Intergenic
1201109004 Y:10785208-10785230 AAGAAGTGCAATGGAGTGGATGG - Intergenic
1202047580 Y:20749986-20750008 AAGAGGGGCCAGTGATAGGAGGG + Intergenic
1202116773 Y:21476523-21476545 CAGGTGGGCAACTGTGTGGAGGG + Intergenic