ID: 1180898610

View in Genome Browser
Species Human (GRCh38)
Location 22:19355163-19355185
Sequence CTTTGGTTCTTAAGGACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180898610 Original CRISPR CTTTGGTTCTTAAGGACCAA AGG Intronic
903343707 1:22671184-22671206 CTTTATTTCTTAAGAACCCATGG - Intergenic
906252825 1:44324435-44324457 GTTTGGTTGATCAGGACCAAGGG + Intronic
906670299 1:47649400-47649422 CTTTTATTCTTATGCACCAAAGG + Intergenic
908875750 1:68673351-68673373 AATTGGTTGTTTAGGACCAAGGG + Intergenic
910069742 1:83197730-83197752 CTTTCCTTCTTAAGCACCTAGGG - Intergenic
910951136 1:92649403-92649425 TATTGGTTCTTAGGCACCAAAGG - Intronic
911184448 1:94889064-94889086 GTTTGGTTCTTAAAGACAAAAGG - Intronic
911519164 1:98908224-98908246 CTGTAGTTCTTTAGGAGCAAAGG + Intronic
916307510 1:163355117-163355139 GTTTGCTACTTAAGGAACAAAGG - Intronic
916869459 1:168896940-168896962 CTGTGGTTCTTAAGGAAAAGTGG - Intergenic
917387292 1:174491245-174491267 CATTGGTTATTCAGGGCCAAAGG + Intronic
918945209 1:191055103-191055125 ATTTTATTCTTAAGGATCAAAGG + Intergenic
920304956 1:205012818-205012840 CTTGGGGTCTTCAGGGCCAAGGG - Exonic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921990544 1:221361355-221361377 CTTTATTTCTTATGGACCGAAGG + Intergenic
923788811 1:237093581-237093603 CTTTGTTTCTCTAGGACCACAGG + Intronic
924888058 1:248241405-248241427 TTTTGCTTCGTAAGCACCAATGG + Intergenic
1063407412 10:5809818-5809840 CATTGGTTTTTAAAGACCACTGG - Intronic
1063691570 10:8292671-8292693 CTTTGGGTCTTCATGTCCAAAGG - Intergenic
1065674640 10:28161527-28161549 TTTTGTTTCTTACTGACCAAGGG - Intronic
1066034024 10:31462532-31462554 CTTTAGTTCTTAAGGACCGATGG + Intronic
1070411121 10:76141741-76141763 CTTTGGGGCTGATGGACCAAGGG - Intronic
1071081074 10:81811867-81811889 CTTTGCTTGTCAAAGACCAATGG - Intergenic
1071680413 10:87699543-87699565 GTTTGATTCTTAAGGTTCAAAGG - Intronic
1072338939 10:94427388-94427410 CTCTGTTGCTTTAGGACCAATGG - Intronic
1073056669 10:100707522-100707544 CTTTAGATCTTAAGGAGCAGTGG - Intergenic
1073771120 10:106736817-106736839 CATTGGTTCTCCAGAACCAAAGG + Intronic
1073939618 10:108680805-108680827 CTTTGTTTCTCAAGGAGCCAAGG + Intergenic
1079134332 11:17767904-17767926 CTTTGTTTCTCAGGGACCAATGG - Intronic
1080663833 11:34318512-34318534 CTTGGGGTCTGAGGGACCAAGGG + Intronic
1084109923 11:67007382-67007404 CTCAGGTTCTGAAGGACCCAGGG + Exonic
1084769859 11:71335542-71335564 CCTGGGTTCAGAAGGACCAAAGG - Intergenic
1092805807 12:12221062-12221084 CATTGGTTCTTAAGGAGAGAGGG - Intronic
1094146644 12:27235618-27235640 ATTTTGTTCTTTAGGTCCAAAGG - Intergenic
1097119570 12:56720975-56720997 CTTTGGTTCTGAGGGAGCAATGG + Exonic
1098274453 12:68799302-68799324 CTTGGGCTCTTAAGGATCTAGGG - Intergenic
1098430045 12:70409042-70409064 CTTTGGATCTAAAGGCCAAAAGG + Intronic
1098702569 12:73647010-73647032 CTTTGGTTCTTAGCAACAAAGGG - Intergenic
1106878251 13:34100206-34100228 CTTTGGTTCTTAATGCCCTAGGG + Intergenic
1107147926 13:37079463-37079485 CTTTGATTCTTAAGGCCATATGG + Intergenic
1114269528 14:21092335-21092357 ATGTGGTTCTTAAGGAACCAGGG + Exonic
1115251886 14:31357646-31357668 CTTTGGTTTTGAAAAACCAAAGG - Intronic
1118067725 14:62210305-62210327 TTTTGTTTATTAAGGACCAGTGG - Intergenic
1123130504 14:105981856-105981878 ATTTCATTCTGAAGGACCAAGGG + Intergenic
1123409950 15:20049943-20049965 ATTTCATTCTGAAGGACCAAGGG - Intergenic
1123519282 15:21056650-21056672 ATTTCATTCTGAAGGACCAAGGG - Intergenic
1123580743 15:21713077-21713099 ATTTCATTCTGAAGGACCAAGGG + Intergenic
1123617392 15:22155700-22155722 ATTTCATTCTGAAGGACCAAGGG + Intergenic
1126519258 15:49572502-49572524 CATTGGTTGTTCAGGAACAATGG + Intronic
1129938020 15:79466824-79466846 CCTTGGATCTGAAGGGCCAAGGG + Intronic
1131055754 15:89373459-89373481 CTTTTTTTTTTAAGTACCAAGGG - Intergenic
1202989613 15_KI270727v1_random:447322-447344 ATTTCATTCTGAAGGACCAAGGG + Intergenic
1132491121 16:231838-231860 CATTTCATCTTAAGGACCAAGGG + Intergenic
1142682761 17:1560218-1560240 GTTTTGTTCCTAAGGAGCAAGGG - Intronic
1147345805 17:39794013-39794035 TTTTGATTTCTAAGGACCAATGG - Intronic
1147477902 17:40730976-40730998 CTTTTGTTTTTAATGACAAATGG + Intergenic
1149180656 17:53932268-53932290 GCTTGGTTCTTGAGGCCCAAGGG + Intergenic
1149335684 17:55633336-55633358 CTTTTGTTCTTCAGGTCCTAAGG - Intergenic
1150093954 17:62355850-62355872 CCTTCTTTCTTAAGGGCCAAGGG + Intergenic
1153107735 18:1547330-1547352 ATATGATTCTTAAGAACCAAAGG - Intergenic
1153696068 18:7643292-7643314 CTATGTTTCTTAAGGCCAAAAGG + Intronic
1153757944 18:8302329-8302351 CTTTAGTTCTTCAGACCCAAGGG - Intronic
1155493900 18:26424496-26424518 CTTTGGTTCAACAGGGCCAAAGG - Intergenic
1156388513 18:36628294-36628316 CTTTGGATATTAAGAGCCAAGGG - Intronic
1157210657 18:45739403-45739425 CTTGGCTTCCTAGGGACCAATGG + Intronic
1157692435 18:49694645-49694667 CTTTGGATCTTAAGGACTGTGGG - Intergenic
1158796445 18:60851739-60851761 CTTTAATTTTTAAGGAACAAAGG - Intergenic
1159510287 18:69389495-69389517 CTTTGGGACTTAAGGAAAAATGG + Intergenic
1160716624 19:579720-579742 CTTTTGTTCTCACGGACCACAGG - Intronic
1162607331 19:11719734-11719756 CTTTGGTTCTAAAGGACCTAGGG - Intergenic
1162677988 19:12314732-12314754 CTTTTGTTTTCAAGGACCCACGG - Intergenic
1163809464 19:19421532-19421554 GCTGGGTTCTCAAGGACCAACGG + Intronic
926977574 2:18530733-18530755 CTTTGGTTTTTTAGGACTAAGGG - Intergenic
928007740 2:27578949-27578971 CTTTGATTATGAAGGGCCAAAGG - Exonic
928214989 2:29353974-29353996 CTCTTGTGCTTAAGGACCAAAGG - Intronic
930257150 2:49105471-49105493 CTTTGTTTTTTAAGCACAAAAGG - Intronic
930817673 2:55616271-55616293 CTTTTGTTCTTAATGAGGAAAGG - Intronic
931509150 2:62970690-62970712 ATTTGATTCTTAAGATCCAAAGG + Intronic
933667994 2:84980263-84980285 CTTGGGTTGGTAAGGACCAGTGG + Intronic
938756488 2:134384451-134384473 GTTTGGTTCTTATGTACAAAGGG - Intronic
939349102 2:141009943-141009965 CTGTGTTTCTTGAGGGCCAATGG + Intronic
940525237 2:154806295-154806317 CTTTGCCTCTCAAGTACCAATGG + Intronic
941868548 2:170359703-170359725 CTTTTGTTCTTTAAGACCCAAGG + Intronic
942401218 2:175605695-175605717 CGTTGTAGCTTAAGGACCAAAGG + Intergenic
942973776 2:181989725-181989747 CTTTGTTTTTTAAGCACCACTGG + Intronic
943702812 2:191004788-191004810 TTTGTGTTCTTAAGGACTAATGG - Intronic
946777989 2:223163857-223163879 TTCTGGTTCTTAAGGATCATGGG + Intronic
946901458 2:224376884-224376906 CTGTGGGTCCGAAGGACCAATGG + Intergenic
1169309112 20:4520019-4520041 CCTTGGGTCCTAAGGATCAAGGG + Intergenic
1174797995 20:53538632-53538654 CTTTGGTTCTGAAGGATGGAGGG + Intergenic
1174890630 20:54388273-54388295 CTTTGGGGCTTAGAGACCAAGGG + Intergenic
1178896788 21:36565355-36565377 GGTTGGTTCTGAAGGACCAATGG - Intronic
1180898610 22:19355163-19355185 CTTTGGTTCTTAAGGACCAAAGG + Intronic
953482037 3:43260070-43260092 CTTTGGTATTTAAGGACAATAGG + Intergenic
954963132 3:54583794-54583816 CTTTGGGTCTTAAAGACAAAAGG + Intronic
956502950 3:69907159-69907181 CTTTCATTCTTTAGTACCAAAGG - Intronic
958521186 3:95188493-95188515 ATTTGGTTCTTAAAGTCCTAGGG + Intergenic
959792676 3:110382615-110382637 GTTTGGGTCTTCAGGTCCAAAGG - Intergenic
961067354 3:123886956-123886978 TTCTGGTTCTCAAGGACAAAAGG + Intergenic
964163348 3:153672002-153672024 CTTTTGGTATTAAGGAGCAATGG - Intergenic
967219930 3:187239935-187239957 CTTCGCTTCTTAAGGATGAATGG + Intronic
970613133 4:17743887-17743909 CTCAGGGTCTCAAGGACCAAAGG + Intronic
971527118 4:27634548-27634570 CATTGGTTGCCAAGGACCAAGGG + Intergenic
974860776 4:67518791-67518813 CTTTGTTTCCTAAAGGCCAAAGG + Intronic
976315027 4:83650990-83651012 CAATGTTTCTTAAGGGCCAAAGG - Intergenic
978565141 4:110073429-110073451 CATTGGTGCTTAAGGGCCCAAGG - Intronic
979087836 4:116436331-116436353 CTTTTGTTCTGAAGGAGAAATGG + Intergenic
981229391 4:142335499-142335521 CTTTGCTTCCTAAGTACCAGAGG + Intronic
982702121 4:158669227-158669249 CGTTTCATCTTAAGGACCAAGGG - Exonic
983301989 4:165937324-165937346 CTTTGGCTCTCAAGGACACAGGG + Intronic
983852421 4:172598059-172598081 CTTAGGTTCCTAAATACCAAAGG - Intronic
984133373 4:175905845-175905867 CTTTTTTTCTTAATGACGAAAGG - Intronic
990979140 5:61586123-61586145 CTTTCGGTCTGAAGGACAAAGGG - Intergenic
991214308 5:64144629-64144651 CTTTGCTGCTTCAGGACTAAGGG - Intergenic
993330266 5:86591070-86591092 ATATGGTTCTTAAGGATCAGGGG - Intergenic
994605240 5:101958765-101958787 GTTTGGTATTTAGGGACCAAGGG - Intergenic
994801354 5:104381099-104381121 ATTTGGTTCTTAGGGAACTAGGG - Intergenic
996461070 5:123743482-123743504 CTTTGATTCTTAAGCACCCCTGG - Intergenic
998061169 5:139119852-139119874 TTTTAGTCCTTAAGGACCAGTGG + Intronic
999885806 5:155921369-155921391 TTTTGGTTCTTAAGGTCTTAGGG + Intronic
1001106487 5:168858860-168858882 CTTTGGTTCCTAAGGCCCCTGGG + Intronic
1008509488 6:52262961-52262983 CTTTGGTTCGTTAGGACAAAGGG - Intergenic
1009701248 6:67184679-67184701 CTTTGCTTCTGAAAGACCACTGG - Intergenic
1011514159 6:88134306-88134328 TTCTGGTTCCTAAGCACCAAGGG + Intergenic
1013661897 6:112306540-112306562 CTTTTGTTCTAAAGGCACAACGG - Intergenic
1016596352 6:145806016-145806038 CCTTGGCTCTTCAAGACCAAAGG - Exonic
1017834143 6:158161659-158161681 CTTAGGACCTTAAGGACCCAGGG + Intronic
1018105033 6:160477692-160477714 CTTTGGCTTTTCAGGAGCAATGG - Intergenic
1018401666 6:163427757-163427779 CTTTGTATCTTAAGCACGAAGGG + Intronic
1021450487 7:20779097-20779119 CTTTGGTTCCTAACGAACAGTGG - Intergenic
1022024409 7:26433039-26433061 ATTTGATTCTTAAGAAGCAAGGG + Intergenic
1023408015 7:39856926-39856948 CTATGCTTCTCAAGGACCCATGG - Intergenic
1025137843 7:56435626-56435648 CTATGCTTCTCAAGGACCCATGG + Intergenic
1031786902 7:126045040-126045062 CTTAGTTTCTTCAGGACTAAGGG - Intergenic
1035588484 8:795174-795196 CTGTGTTTCTTCAGGAGCAAGGG - Intergenic
1039370950 8:36983289-36983311 CTATGGTTCTTAATGCCCTAAGG + Intergenic
1042372433 8:68006767-68006789 TGTTGGTTCTTGAGGACCTAAGG + Intronic
1043527870 8:81115693-81115715 CTTTGGTTGCTGAGGAGCAAAGG + Intergenic
1044417567 8:91953593-91953615 CTTTGGTTCAGAGAGACCAAGGG + Intergenic
1044719603 8:95133361-95133383 CTTTGGATCTAAATGCCCAAAGG - Intergenic
1044790382 8:95841082-95841104 CTGTGGCTCTTAAGGATGAAGGG - Intergenic
1047294065 8:123555612-123555634 CTCTGGGTCTTAAGGGACAAGGG - Intergenic
1050721535 9:8596851-8596873 CTTTGGTTTTTAAGGTGCTATGG + Intronic
1052308413 9:27037725-27037747 ATTTTGTTCTTAAGGACCCAGGG - Intronic
1058066215 9:100550986-100551008 CTTTGATAGGTAAGGACCAATGG + Intronic
1061109242 9:128555741-128555763 ACTTGGTTTTTAAGAACCAAGGG + Intronic
1061204420 9:129154785-129154807 GTTTGGTGGTTAAGAACCAAGGG + Intergenic
1061878945 9:133558949-133558971 CTTTGGATTTTAAGCACCAAAGG - Intronic
1061878946 9:133558950-133558972 CTTTGGTGCTTAAAATCCAAAGG + Intronic
1062364479 9:136202351-136202373 CTTTGGTTCTTAGGGAACCTGGG - Intronic
1186170487 X:6871565-6871587 CCTTGGTTCTTAAGAACAACAGG - Intergenic
1187134189 X:16530701-16530723 CTTTGGTTCTTACAGAAAAAAGG + Intergenic
1192078135 X:68021068-68021090 CTCTGGTTCTTAAGCACCAGTGG + Intergenic
1193892932 X:87073300-87073322 CTTTGGTTCTTAAAAAGCCATGG - Intergenic
1194821825 X:98517737-98517759 CTTTTGTTCATAACGACAAAGGG + Intergenic
1195485640 X:105402583-105402605 CTTTGTTCCTGAAGGACAAACGG + Intronic
1196517581 X:116631290-116631312 TGCTGGTTATTAAGGACCAAAGG - Intergenic
1198462776 X:136879549-136879571 CTTTAGTTATTAAGGAACAATGG - Intronic
1199760747 X:150902373-150902395 CTCTGGTCCCTAAGGATCAATGG - Intergenic