ID: 1180902085

View in Genome Browser
Species Human (GRCh38)
Location 22:19381079-19381101
Sequence TTTCTTTGAAGCCTCTCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180902083_1180902085 24 Left 1180902083 22:19381032-19381054 CCATCCTAGCTAATCAATGGTAT 0: 1
1: 0
2: 0
3: 9
4: 75
Right 1180902085 22:19381079-19381101 TTTCTTTGAAGCCTCTCAGTAGG 0: 1
1: 1
2: 2
3: 17
4: 249
1180902084_1180902085 20 Left 1180902084 22:19381036-19381058 CCTAGCTAATCAATGGTATGAAT 0: 1
1: 0
2: 1
3: 7
4: 127
Right 1180902085 22:19381079-19381101 TTTCTTTGAAGCCTCTCAGTAGG 0: 1
1: 1
2: 2
3: 17
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180902085 Original CRISPR TTTCTTTGAAGCCTCTCAGT AGG Intronic
901260971 1:7870416-7870438 TGTCATTGAAGCCTCTCAGTCGG + Intergenic
902376863 1:16034009-16034031 TTTCTCAGGAGCCTCTCACTGGG - Exonic
902382029 1:16057267-16057289 TTTCTCAGGAGCCTCTCACTGGG - Exonic
903731919 1:25503055-25503077 TGTCTTGGAAGCCTCGCAGCAGG + Intergenic
903992359 1:27282353-27282375 TTTCCTTGGATCCTCTCAGGAGG - Intronic
904516878 1:31062756-31062778 TGTTTTTGAAGCATCACAGTGGG - Intronic
904969633 1:34409014-34409036 TTTCATTGAGTCCTCTGAGTTGG + Intergenic
905821520 1:40996013-40996035 TTTCTTGGCTGCCTCTCAATAGG - Exonic
906216731 1:44045510-44045532 TTTCTTTGAACCTTCTTAGGTGG + Intergenic
906732274 1:48093236-48093258 TTTATTTGATGCCTCTCACCTGG - Intergenic
907586444 1:55621958-55621980 TTTCTTTGTAGACTCTGAGAAGG - Intergenic
908019563 1:59886225-59886247 TTGGCTTGAAGCCTCTCAGCTGG - Intergenic
909607552 1:77522257-77522279 TTTCTATGAAGCCACTTAGATGG - Intronic
909671645 1:78195863-78195885 GTTCTTTTAAGCCACTCAGTTGG - Intergenic
910613800 1:89174615-89174637 TTTCTTGCAAGCCCCTCTGTGGG + Intronic
913414308 1:118588627-118588649 TTTCTCTGAAGCCTGTTACTTGG - Intergenic
913485029 1:119326454-119326476 TTTCTTTGGAGCCATTCAGGGGG - Intergenic
918625171 1:186649091-186649113 TTTCTTTAAAGACTCTGAGTTGG + Intergenic
919535682 1:198784746-198784768 TTTCTTTGTAGTCTCTTTGTTGG - Intergenic
920800960 1:209186936-209186958 TTACTTTAAAGCCACTCATTAGG + Intergenic
921257128 1:213352602-213352624 GCTCTTTGAAGCTTCTCAGTTGG + Intergenic
921691846 1:218160663-218160685 TTTCTTTGAAACAACTCAGAAGG - Intergenic
922252046 1:223858200-223858222 CTTGTCTGAAGCCTCCCAGTTGG + Intergenic
923210090 1:231796004-231796026 GTTCTTTAAAGCTTTTCAGTTGG + Intronic
924049729 1:240068560-240068582 TTTCTTTGAATCCTGTGTGTTGG + Intronic
924215088 1:241812654-241812676 TTTTTGTGAAGACTCTGAGTTGG - Intergenic
924404862 1:243732072-243732094 TTTATATTCAGCCTCTCAGTGGG - Intronic
924714987 1:246565398-246565420 TTTGTTTGAAGCTCCTTAGTTGG - Intronic
1064850680 10:19705821-19705843 TTCCTTTGAAGCCTCTCTTGTGG - Intronic
1065032108 10:21597861-21597883 TTTTTTTGCATCCTATCAGTTGG + Intronic
1067697468 10:48546281-48546303 GTTCTTGTAAGCCCCTCAGTTGG + Intronic
1068272746 10:54750569-54750591 TTTCTTTGAAGACAATAAGTTGG + Intronic
1068965339 10:62906333-62906355 TTTCTTTGAAGCCTAGCACAGGG - Intronic
1071730632 10:88244811-88244833 TTGCTGTAAAGTCTCTCAGTTGG - Intergenic
1074001908 10:109381930-109381952 TTTCTTTTTAACCTTTCAGTGGG + Intergenic
1075310160 10:121407132-121407154 TTTATTGGAAGCATCTCAGCTGG - Intergenic
1075594594 10:123719474-123719496 TTGTTTTGCAGCATCTCAGTTGG + Intronic
1076205803 10:128601504-128601526 CTTCTTTTATGCCTCCCAGTAGG + Intergenic
1077270494 11:1676571-1676593 TTTCTTTAATTCCTCTCAGCAGG + Intergenic
1077764232 11:5140451-5140473 TATCTTTGGAGCCATTCAGTAGG - Intergenic
1077794100 11:5472634-5472656 TTCCTTTGAAACTTCTAAGTGGG - Intronic
1078862557 11:15263843-15263865 TTTCTTTGCTGGCTGTCAGTGGG + Intergenic
1080515199 11:33014122-33014144 TTTCTTTGTAATCTCTCAATTGG - Intergenic
1082672491 11:56052665-56052687 ATTGTTTTAAGCCTCTCATTTGG + Intergenic
1082756562 11:57082462-57082484 TTTTTTTGCAGGCTGTCAGTTGG - Intergenic
1084712416 11:70852260-70852282 TTTCTTTAAAGCTTCTAAGCAGG - Intronic
1086367074 11:86118049-86118071 TTTCTGTCTAGACTCTCAGTGGG + Intergenic
1086633192 11:89049089-89049111 TTACTTTGAAGACTCTCTGGAGG - Intronic
1087815607 11:102655046-102655068 TTTCTTTGAAACCTCCCCATGGG + Intergenic
1088278852 11:108116921-108116943 TTTGTTTTAAGCCACCCAGTTGG + Intergenic
1089727992 11:120499874-120499896 TTTCTTTAAAGAATCTCAGTGGG + Intergenic
1090384888 11:126351988-126352010 TTTCCTTGAAACCTCTTGGTTGG - Intergenic
1092668614 12:10836324-10836346 TGTCTTTGCAGTCTCTTAGTAGG - Intronic
1093436784 12:19144410-19144432 TTTCTTTGTAGCGTGGCAGTTGG + Intronic
1093855988 12:24103068-24103090 TCTCAAAGAAGCCTCTCAGTGGG - Intergenic
1095259391 12:40081413-40081435 GTTCTTTGAATCAACTCAGTTGG - Intronic
1097475815 12:60054490-60054512 TTTCTTGGAAGAATCTTAGTTGG + Intergenic
1099121760 12:78698617-78698639 TGTCCTTGAAGACTTTCAGTGGG - Intergenic
1100822507 12:98444595-98444617 GTTCTTTGGAGACTCTCTGTTGG - Intergenic
1100832015 12:98524902-98524924 TTTCTTGAAAACCTCTCAGGCGG + Intronic
1101633752 12:106520308-106520330 TTTCTTTGAAGCCTCTCTTGTGG - Intronic
1103206884 12:119136771-119136793 TTTCTTTGAAGCCTCTCCTGAGG - Intronic
1107509720 13:41071516-41071538 TTTGCTTTAAGCATCTCAGTGGG + Exonic
1108519388 13:51232926-51232948 TTTAATTGCAGCCTCTGAGTTGG + Intronic
1109984323 13:69957807-69957829 TTTCTTTTAAGACTTTCAATTGG - Intronic
1110068350 13:71139381-71139403 TTTATTTGAAGCATCTCTTTTGG - Intergenic
1110139766 13:72114233-72114255 TTTCTTTTATGACTGTCAGTGGG + Intergenic
1111905152 13:94246895-94246917 TTTCTTTGAAGAGTGTCATTGGG + Intronic
1112004071 13:95238902-95238924 TTTCTTGGAAGCCTAACATTTGG - Intronic
1112889824 13:104215453-104215475 TTTCTCTGAATCCTTCCAGTAGG + Intergenic
1114988990 14:28264005-28264027 TTTCTTTGCTGCCTCCAAGTTGG + Intergenic
1115333069 14:32219087-32219109 TTTGTTTGAAGCTTCACAGGAGG + Intergenic
1116190278 14:41656336-41656358 TTTCTTTCATGCCTTTAAGTGGG - Intronic
1116629781 14:47315449-47315471 TTTCTTGGCAGGGTCTCAGTAGG + Intronic
1117473113 14:56066775-56066797 CTTCTTGGTAGCCTCACAGTTGG - Intergenic
1117791640 14:59348310-59348332 TTTCTTTGTAGCCTCTCCAACGG + Intronic
1119222444 14:72920108-72920130 TTCTTTTGAATCATCTCAGTCGG - Intergenic
1119647670 14:76360078-76360100 GTGCTCTGATGCCTCTCAGTGGG + Intronic
1119665049 14:76479526-76479548 TTTATTGGAAGCCTATCAGGAGG + Intronic
1119924140 14:78475507-78475529 TTTCTTTCAAGTATCTCAGGTGG + Intronic
1120991037 14:90377460-90377482 CTTCTTAGAAGCCTCACAGAAGG - Intergenic
1121234850 14:92384742-92384764 TTTCTTTGCATCCTGCCAGTAGG - Intronic
1125226927 15:37405914-37405936 TTTCTTGGAATCCTCACACTTGG + Intergenic
1126048136 15:44663429-44663451 TTTCTTTGACGCCTGGCAGCCGG - Exonic
1126362663 15:47862274-47862296 TTTCCTTGAAGACTTCCAGTGGG - Intergenic
1127058928 15:55162151-55162173 TTTTTTTGAGGACTCTCATTTGG - Intergenic
1129048889 15:72761448-72761470 TTCCCCTGAAGTCTCTCAGTTGG - Intronic
1129825891 15:78634795-78634817 TCTCTTTGCTGCCTCTGAGTTGG - Intronic
1130097994 15:80870464-80870486 TTGCTCTGCAGCCTCTCAGGAGG + Intronic
1132028279 15:98420931-98420953 TTTCTCTTAAGCCTCCCAGGTGG + Intergenic
1133416789 16:5613119-5613141 TTTCTTTGAGGGGCCTCAGTTGG + Intergenic
1133508842 16:6438626-6438648 CTTATTTGAACCCTCTGAGTTGG + Intronic
1133946103 16:10349914-10349936 GTTGTTTTAAGCCTCCCAGTCGG + Intronic
1137332814 16:47516307-47516329 TTTATTTGTAGGATCTCAGTAGG + Intronic
1137381189 16:48001347-48001369 TGTCTTTGGAAACTCTCAGTTGG + Intergenic
1139893560 16:70270195-70270217 TTACTTTGAAGCCATTCAGAAGG - Exonic
1141394857 16:83695568-83695590 TTTCTTTGGAGCCTAGCTGTGGG - Intronic
1143319253 17:6057360-6057382 TTTTTTTTAAACCTCTCAGCTGG + Intronic
1147010432 17:37442211-37442233 TTTTTTTTTTGCCTCTCAGTTGG + Intronic
1148656338 17:49286553-49286575 TTTGTTTGAAGTCACTCAGTTGG + Intergenic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1152003581 17:77662749-77662771 GTTCTTTGAAGCCACTCACTTGG + Intergenic
1152012349 17:77726332-77726354 TTTCTTTGATCCGTCTGAGTTGG + Intergenic
1153292347 18:3513918-3513940 TTTCCTTTAACCCTCCCAGTGGG + Intronic
1154250049 18:12736876-12736898 TTTCTTTGTGGCCTCTAAGGAGG + Intergenic
1157707921 18:49823639-49823661 TTTCCATGAAGCATGTCAGTGGG - Exonic
1158173559 18:54626978-54627000 TGACTTTGGAGCCTCTCAGCAGG - Intergenic
1158689643 18:59648983-59649005 TTAGTTTGAAGCGTGTCAGTAGG - Intronic
1158808277 18:61001134-61001156 TTTCTTTGATGGCTAGCAGTAGG + Intergenic
1159863268 18:73674253-73674275 CTTCCTTGAACCTTCTCAGTGGG - Intergenic
1165820951 19:38675763-38675785 GCTCTATGAGGCCTCTCAGTTGG - Intronic
1167120601 19:47514395-47514417 TCTGTTTGAAGGCTCTCAGGCGG - Intronic
1167528402 19:49999922-49999944 CTTCATTGAATCCTCCCAGTAGG - Intronic
1168279663 19:55298113-55298135 TTTATTTAAACCCTCACAGTGGG - Intronic
926529234 2:14021606-14021628 TGTCTTAGAATCCTCACAGTAGG - Intergenic
926712698 2:15894713-15894735 TTGTTTTGAAGTCACTCAGTGGG + Intergenic
927152899 2:20205861-20205883 GTTTTTGAAAGCCTCTCAGTGGG - Intronic
928614560 2:33024360-33024382 TTGCTTAAATGCCTCTCAGTAGG - Intronic
928756742 2:34535313-34535335 TTTCTTTAAAGGATGTCAGTAGG + Intergenic
929049679 2:37825494-37825516 TTTCTTTGAAGCCCCTCTAGAGG - Intergenic
930393040 2:50785557-50785579 TGTATTTTAAGCCACTCAGTTGG + Intronic
930592350 2:53343048-53343070 TTTTTTTGAATAGTCTCAGTAGG + Intergenic
930936357 2:56957025-56957047 TTTGTTTTAAGCCACTAAGTTGG + Intergenic
931219632 2:60277530-60277552 CTTCTCTGAAGCAGCTCAGTTGG - Intergenic
932269592 2:70398089-70398111 TTTTTTTGAAACGGCTCAGTGGG - Intergenic
932863321 2:75316735-75316757 TTTCCTAGAAGCCTCTCATGAGG + Intergenic
933228064 2:79773710-79773732 TTTGCATGAGGCCTCTCAGTGGG - Intronic
933358819 2:81250881-81250903 TTTCTTTGTTCTCTCTCAGTAGG - Intergenic
935945931 2:108286763-108286785 TTTCCTTGAAGCCTTTCCTTAGG - Intergenic
937776695 2:125786177-125786199 CTTCTCTGAAGCCACTCAGAAGG + Intergenic
941064908 2:160890950-160890972 TTTCTTTCAGGCCTCAGAGTAGG - Intergenic
941907223 2:170728552-170728574 GTTGTTTGAAGCCTCTAAGTTGG - Intergenic
942081619 2:172404649-172404671 TTTCTTTCAAGCAACTCAATGGG + Intergenic
942259048 2:174139336-174139358 TCTCTCTGAAGCCTCTCTGGGGG - Intronic
943380537 2:187139621-187139643 GTTGTTTTAAGCCACTCAGTTGG - Intergenic
944112052 2:196143189-196143211 TGTCTTTGAAGCCTGGCTGTTGG - Intronic
944627700 2:201589220-201589242 GTTCTTTGAAGAATCTCAATGGG - Intronic
945889954 2:215419835-215419857 TTTCTTAGAAGCTGCTCAGCAGG - Intronic
948389027 2:237598804-237598826 TTTCTTTTAAGCCACTAACTTGG - Intronic
948731511 2:239966728-239966750 TTTCTTTGTAGCCTTCCGGTTGG - Intronic
1168809146 20:692500-692522 GTTGTTTGAAGCCACTAAGTTGG - Intergenic
1171767668 20:29299021-29299043 TTTCTTGGAAGCTGCCCAGTGGG + Intergenic
1172673635 20:36651731-36651753 TTTCTTTCAAGCCATTCACTGGG - Intergenic
1174306632 20:49618037-49618059 TTTGTTTAAAGCCACTGAGTTGG - Intergenic
1177510480 21:22080495-22080517 TTTCTTTTCTGCCTCTCTGTAGG - Intergenic
1178439799 21:32589352-32589374 TTTCTTTTAAGTCTTTCTGTAGG + Intronic
1179037290 21:37769567-37769589 TTTCTCGGAGGCGTCTCAGTGGG - Intronic
1179321982 21:40300920-40300942 TTCCTTAGAAGGCTCCCAGTAGG + Intronic
1180902085 22:19381079-19381101 TTTCTTTGAAGCCTCTCAGTAGG + Intronic
1181321899 22:22013985-22014007 TTGGTTTTAAGCCACTCAGTTGG + Intergenic
1182370021 22:29804239-29804261 CTTCTTGGAAGCCCCTCCGTGGG - Intronic
1183009705 22:34934763-34934785 TATCTTTGGAGCCTCCCAGGAGG - Intergenic
1183038005 22:35154813-35154835 CTTCTTTGAATCTTCTCTGTTGG + Intergenic
1183287046 22:36973382-36973404 TTTCTCTAGAGCCTCTCACTGGG + Intergenic
1184390013 22:44198140-44198162 TATCTTTGAAGAGTCTCAATAGG + Intronic
949490940 3:4588347-4588369 TTTTTTTAAAGCCTGTTAGTGGG + Intronic
949635029 3:5973413-5973435 TTTCCTTGATGGCTGTCAGTCGG - Intergenic
949856015 3:8462029-8462051 TTTCACTGAAACCTCTCAGCTGG - Intergenic
949955908 3:9268443-9268465 CAACTTTGGAGCCTCTCAGTCGG - Intronic
952439129 3:33306697-33306719 TTTCTTGGAAGATTCACAGTTGG + Intronic
953364167 3:42327896-42327918 TTCCTTTGAACTCTCTGAGTTGG + Intergenic
953738604 3:45517215-45517237 TTTCTAAGAAGCCTCCCAGAAGG + Intronic
953864817 3:46575229-46575251 TTTCTCTCCAGCCTCACAGTGGG + Intronic
954570692 3:51638389-51638411 CTTTATTGAAGACTCTCAGTAGG - Intronic
954572944 3:51657459-51657481 TTTCCCTACAGCCTCTCAGTGGG - Intronic
954661294 3:52228303-52228325 TTTCTTCGAAGCCACTAAGTTGG + Intergenic
955936851 3:64110355-64110377 GATCTTTGAAGCAACTCAGTGGG - Intronic
958182252 3:90074451-90074473 TTACTGTTAAGCATCTCAGTAGG - Intergenic
958937946 3:100278111-100278133 ATTCTTAGATGCCTATCAGTGGG + Intronic
959896790 3:111615230-111615252 TTTCTGTGGATCCTCTCAGTGGG - Intronic
960487753 3:118273914-118273936 ATTCTATGAAGACTCACAGTGGG + Intergenic
960945514 3:122963825-122963847 GTTCTTTCTACCCTCTCAGTTGG + Intronic
961266161 3:125644640-125644662 TGTCTTTTGAGCTTCTCAGTGGG + Intergenic
963010096 3:140760578-140760600 TTTTTCAGAAGCCTCTCAGGAGG - Intergenic
963512447 3:146264999-146265021 ATTCTTTGAAGCATTACAGTTGG - Intergenic
965791065 3:172388323-172388345 TTACTTTAAATCCTCTCATTTGG + Intronic
967355672 3:188568120-188568142 TTTATATGAAGCTCCTCAGTAGG - Intronic
968349161 3:198038219-198038241 TTTCTTTGTACCTTCTAAGTAGG - Intronic
969258627 4:6020136-6020158 TGTCTTTGCAATCTCTCAGTGGG + Intergenic
971751336 4:30653074-30653096 CTTCTGTGAAGTCTCTCACTAGG - Intergenic
971789286 4:31147505-31147527 TCTCTTTTAAGTCTCTGAGTTGG - Intergenic
973719355 4:53707586-53707608 TTCTTCTGAGGCCTCTCAGTTGG + Intronic
974730562 4:65859453-65859475 TTTATTTCAAGCTGCTCAGTAGG + Intergenic
975059249 4:69977409-69977431 TTTCTTTGAATTAACTCAGTCGG - Intergenic
976758460 4:88523454-88523476 TTCCTTTGCAGCCTCCCGGTGGG - Intronic
978843355 4:113242248-113242270 TTTCTTTCAAGCCTCATAGAAGG + Intronic
979370555 4:119881074-119881096 TTATTAAGAAGCCTCTCAGTAGG - Intergenic
980210406 4:129780209-129780231 ACTCTGTGAAGTCTCTCAGTGGG + Intergenic
980762749 4:137257275-137257297 TTTCTTTGAGGCTTTTCAGATGG - Intergenic
984002885 4:174272000-174272022 TTTCTTTGTAGCCCCTAAGGGGG - Intronic
984213654 4:176880857-176880879 GTTGTTTTAAGCCACTCAGTTGG - Intergenic
984380353 4:178985241-178985263 TTTCTTTGAAGTCTCTGACCTGG + Intergenic
986193091 5:5514828-5514850 TTTATTTGAAGCCCCACATTGGG + Intergenic
986957006 5:13164583-13164605 TTACATTGTAGCCTCTCAGAAGG - Intergenic
987020258 5:13863346-13863368 TTTCCTTGAAACATCTCAGCAGG - Intronic
989276842 5:39599127-39599149 ATTCTTAGCAGCCACTCAGTTGG - Intergenic
992656561 5:78916186-78916208 TTTCTTTTAAGGCTCTCAGCAGG + Intronic
993955246 5:94224775-94224797 TCTCTTTGTAGGCTCTCATTTGG + Intronic
994785210 5:104151148-104151170 TTTGCTTGAATCCTCTCAGTTGG + Intergenic
996619738 5:125485576-125485598 TTTCTTTGCAGCATGTCAGGAGG - Intergenic
997175106 5:131767122-131767144 TTTCTTTTAAGCCTGATAGTAGG - Intronic
1000508212 5:162148310-162148332 TTTCTTTGAATCTTCACAGCAGG - Intronic
1003279073 6:4676355-4676377 CACCTTTGCAGCCTCTCAGTCGG + Intergenic
1004299754 6:14446533-14446555 GTTTTTTGAAGCCTCTCAGTTGG - Intergenic
1004446595 6:15705707-15705729 TTTCTTGTAAGCCTCGGAGTTGG - Intergenic
1004658985 6:17693113-17693135 TTTCTCTGAATCCACTCACTTGG + Intronic
1004994173 6:21172162-21172184 TTTCCTTGAACCCTCACAATCGG + Intronic
1009380590 6:63023924-63023946 TTTCTTGGATGCCTGCCAGTAGG - Intergenic
1009611156 6:65943076-65943098 TTTCTGTGAAGCTTTTTAGTTGG + Intergenic
1009702070 6:67197009-67197031 TTTATTTGAAGCCTGTTAGTTGG - Intergenic
1011237597 6:85234421-85234443 TTTTTTTAAAGCCTCACTGTAGG - Intergenic
1012983178 6:105851245-105851267 TTTCTTTAAAGCCCCAGAGTGGG - Intergenic
1014656544 6:124113046-124113068 TTTTTTTGGAGCATCTTAGTCGG + Intronic
1015103766 6:129511957-129511979 TATCTTAGAAGTCTCTCTGTTGG - Intronic
1015142848 6:129955300-129955322 TTTCTTTGCTGCCTTTCTGTTGG + Intergenic
1016647458 6:146426363-146426385 TTTCTTAAAACCCTGTCAGTGGG - Intronic
1016760051 6:147726925-147726947 TTTGCTAGTAGCCTCTCAGTTGG + Intronic
1017076024 6:150619565-150619587 TTGGTATGAAGCATCTCAGTGGG - Intronic
1018280242 6:162178115-162178137 TTTCTGTGAAGCCACTAGGTAGG + Intronic
1018307505 6:162473017-162473039 TTTCTTTGAAGGACCTGAGTAGG - Intronic
1020051315 7:5083789-5083811 TTTCTTACAAGCTCCTCAGTAGG - Intergenic
1027007974 7:74712353-74712375 TTTCATTGAAGCCTTTCTTTGGG + Intronic
1027825630 7:83111570-83111592 TTTCTTTGTGGACTCTCAGCTGG - Intronic
1028531830 7:91846777-91846799 TTTCTTTGATGGCACTCACTGGG + Intronic
1028747745 7:94347009-94347031 TTTCTTTTAGCCCACTCAGTAGG - Intergenic
1030233745 7:107235804-107235826 ATTTTTTAAAGCCTTTCAGTAGG - Intronic
1030243024 7:107350011-107350033 TTTCTTAGATGCCTTTCATTAGG + Intronic
1032432383 7:131872434-131872456 TTTCTCTGAAGCCACTCACCTGG - Intergenic
1034414351 7:150956867-150956889 CTCATTTGAAGCCTCCCAGTTGG + Intronic
1034527847 7:151677066-151677088 GTTGTTTTAAGCCACTCAGTCGG + Intronic
1035764402 8:2094227-2094249 TTTCTTTGAAGCCTCTCGGTTGG + Intronic
1036467270 8:9012120-9012142 TTTTTTTGAAGCTTTTCAGTTGG + Intronic
1036724559 8:11208184-11208206 TCTCTTTGAAGCATTTCAGCAGG - Intergenic
1039888657 8:41669981-41670003 ATTCCTTGAAGTCTCTCAGCTGG + Intronic
1041337570 8:56804292-56804314 TTCCCTTGAATCCTTTCAGTTGG - Intergenic
1041388471 8:57328697-57328719 TTTCTTGGAAGTCTCTGTGTAGG - Intergenic
1042781554 8:72496283-72496305 TTTCCTTGCTGCCTGTCAGTTGG - Intergenic
1043397576 8:79853791-79853813 TCTATTGGTAGCCTCTCAGTGGG + Intergenic
1043465405 8:80501394-80501416 TTTATTTGAAGAAGCTCAGTGGG + Intronic
1043835275 8:85038202-85038224 ATTCTTTGTAACTTCTCAGTTGG + Intergenic
1044265116 8:90172973-90172995 TTCCTTTGAACCCTTTGAGTTGG + Intergenic
1045414980 8:101957063-101957085 TTACTTTCAAGCATCCCAGTGGG - Intronic
1049848919 8:144820446-144820468 ATGCTTTGCAGCTTCTCAGTGGG - Intergenic
1050110119 9:2206672-2206694 TTTCCTTTAAGCCTCTTATTTGG + Intergenic
1050584016 9:7091155-7091177 TTTCTTTCGAGGCTCTCAGATGG + Intergenic
1052675532 9:31617512-31617534 TTTCCTTGATGGCTCTCAGCTGG - Intergenic
1055357452 9:75451932-75451954 TTTCTTAAAATCCTCTCAGTAGG - Intergenic
1057128859 9:92639658-92639680 TTTGTTTGAAGCCTGTCATAAGG - Intronic
1059963791 9:119593482-119593504 GTTATTTTAAGCCACTCAGTTGG + Intergenic
1060196913 9:121629691-121629713 CTTATCTGAAGCCCCTCAGTGGG - Intronic
1185975714 X:4717765-4717787 CTTATTTGAAGACTATCAGTAGG - Intergenic
1186273882 X:7919433-7919455 TTTCTTTGCTGGCTGTCAGTGGG + Intronic
1186973091 X:14871231-14871253 TGTTTTTGAAGTCTTTCAGTGGG - Intronic
1187024641 X:15421736-15421758 TCTCTTTGAAGAGTTTCAGTAGG - Intronic
1187292368 X:17967366-17967388 TTTCTTTCAAGGGTCTCAGATGG + Intergenic
1187302186 X:18061391-18061413 TTTTTTTCAAGCCCCTCAGTAGG + Intergenic
1187716360 X:22106411-22106433 TTTCTGTGAAGCATCTTTGTTGG + Intronic
1188035311 X:25311329-25311351 TTTTTTGGAATCCTTTCAGTAGG + Intergenic
1190047099 X:47121152-47121174 GTTGTTTTAAGCCACTCAGTTGG - Intergenic
1190993210 X:55574897-55574919 TTTCTTTGAAGCATTTTAGAAGG - Intergenic
1191997479 X:67111441-67111463 TTTCTTTGCAACCTCTGAGATGG + Intergenic
1192441524 X:71178175-71178197 ACTCTTTGAAGCCTCTCTTTTGG - Intergenic
1192605517 X:72512796-72512818 CTGCTTGAAAGCCTCTCAGTAGG + Intronic
1193234619 X:79091677-79091699 TTTCTTTTAAGCCACTCAACAGG - Intergenic
1195222977 X:102763910-102763932 TTTCCTTGATGACTGTCAGTTGG - Intergenic
1198842047 X:140867675-140867697 TTTATTTGAATACTTTCAGTAGG - Intergenic
1198955890 X:142129872-142129894 GTTATCTGAAGCCTCGCAGTGGG - Intergenic
1199095856 X:143737655-143737677 TTTCTTTTAATCCTCCTAGTAGG - Intergenic
1201313101 Y:12615304-12615326 TTTCTCTCAGGCCTCTCAGGGGG + Intergenic
1201534228 Y:15028026-15028048 TCTCTTTGTAACCACTCAGTTGG - Intergenic