ID: 1180906856

View in Genome Browser
Species Human (GRCh38)
Location 22:19419665-19419687
Sequence AGCCACAGCTCTGGGTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 2, 1: 0, 2: 10, 3: 41, 4: 505}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180906856_1180906862 27 Left 1180906856 22:19419665-19419687 CCTCAGGACCCAGAGCTGTGGCT 0: 2
1: 0
2: 10
3: 41
4: 505
Right 1180906862 22:19419715-19419737 ACTTGTTGCTGTTGAATGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 156
1180906856_1180906860 -9 Left 1180906856 22:19419665-19419687 CCTCAGGACCCAGAGCTGTGGCT 0: 2
1: 0
2: 10
3: 41
4: 505
Right 1180906860 22:19419679-19419701 GCTGTGGCTTGGCACATAACAGG 0: 1
1: 0
2: 2
3: 18
4: 122
1180906856_1180906861 23 Left 1180906856 22:19419665-19419687 CCTCAGGACCCAGAGCTGTGGCT 0: 2
1: 0
2: 10
3: 41
4: 505
Right 1180906861 22:19419711-19419733 AAAAACTTGTTGCTGTTGAATGG 0: 1
1: 0
2: 4
3: 43
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180906856 Original CRISPR AGCCACAGCTCTGGGTCCTG AGG (reversed) Intronic
900203107 1:1420072-1420094 GGCCACAGCGCTGGGTCTGGCGG - Exonic
900274818 1:1818121-1818143 GGCCACAGCTGTGGGTCCCCAGG - Intronic
900411932 1:2516483-2516505 AGCCGCTGCTCTGGGACCAGAGG + Intronic
900415204 1:2531568-2531590 AGCCCCAGCTCTGGGGGCTAAGG - Intergenic
900422266 1:2560732-2560754 AGGCCCAGCTCTGTGCCCTGGGG + Intronic
900550328 1:3251336-3251358 AGGCACAGCTCTGGGTACCGAGG + Intronic
900580494 1:3406223-3406245 AGGCACAGCTCTGGGTGCAGCGG + Intronic
900952411 1:5865402-5865424 GGCCCCAGCTCTGCCTCCTGTGG - Intronic
901208043 1:7508571-7508593 AGGCACAGTGCTGGGTGCTGGGG - Intronic
902715206 1:18268049-18268071 AGGCACAGTTCTGGGCACTGGGG - Intronic
903222946 1:21878968-21878990 AGCCCCAGCTCCGGGTCAGGGGG - Intronic
903738303 1:25544018-25544040 AGCCCGAGCTCGGGGTCCTCAGG + Intronic
903739464 1:25550238-25550260 AACAACAGCTCTGACTCCTGGGG - Intronic
903787504 1:25871279-25871301 AGCCACATCTCTTGGGCCTGTGG - Intergenic
903851039 1:26306325-26306347 CGCCAGAGCTCTGGGCTCTGGGG - Intronic
903928696 1:26849837-26849859 CGGCACTGCTCTGGATCCTGGGG + Intronic
903968962 1:27106835-27106857 AGTCACAGACCTGGGTTCTGTGG + Intronic
904334394 1:29787435-29787457 TCCCACAGCTCTGGGTCTTCAGG + Intergenic
904493949 1:30876555-30876577 AGCCACCTCTGTGGGTCCAGGGG + Exonic
904908947 1:33919877-33919899 AGCCACTGTTCTAGGTGCTGGGG + Intronic
905224999 1:36473150-36473172 AGGCACTGCTCTAGGTACTGGGG - Intronic
905247481 1:36625241-36625263 GTCCCCAGCTCTGGGTCTTGTGG + Intergenic
905394916 1:37660907-37660929 AGCCGCAGGTCTGGGTCAAGGGG - Intergenic
905900576 1:41579784-41579806 GGCCACAGCTCCGCATCCTGAGG - Exonic
906700183 1:47852134-47852156 AGCCACCGCCATGGGCCCTGGGG + Intronic
906731835 1:48089566-48089588 GTGCACAGCTCTGGGTCCAGTGG - Intergenic
908687029 1:66732343-66732365 AGCAACAGCTCTGGGAGCTTGGG + Intronic
908732210 1:67237907-67237929 AGGCACTGTTCTGGGTACTGGGG + Intronic
909206191 1:72760708-72760730 AGCCACAGCTGTGGTAGCTGAGG + Intergenic
909932003 1:81506930-81506952 AGTCACTGTTCTAGGTCCTGGGG + Intronic
909957721 1:81800828-81800850 AGGCAGAGCTCGGGGACCTGGGG + Intronic
910602940 1:89050804-89050826 AGACGCAGTTCTGTGTCCTGAGG + Intergenic
910637780 1:89428446-89428468 AGACACTGTTCTGTGTCCTGAGG - Intergenic
911115757 1:94245871-94245893 AGCCACTGCTCTTGGTCCCGGGG - Intronic
911170922 1:94770139-94770161 AGCCACTGCTCTAGGTGCTGGGG + Intergenic
912721645 1:112025313-112025335 AGCCTTAGCTCTGTCTCCTGGGG - Intergenic
912778500 1:112522599-112522621 AGCCATAGCTCTGGGCCACGGGG + Exonic
913517637 1:119617975-119617997 AGTCACAGCCTTGGGGCCTGGGG + Intergenic
913969801 1:143406090-143406112 AGGAAGAGCTCAGGGTCCTGTGG + Intergenic
914064174 1:144231685-144231707 AGGAAGAGCTCAGGGTCCTGTGG + Intergenic
914114976 1:144734669-144734691 AGGAAGAGCTCAGGGTCCTGTGG - Intergenic
914992628 1:152511838-152511860 TGCCACAGCTCTGGGGGCTCTGG + Exonic
915020762 1:152776632-152776654 AGTCAGAGCTCTGGGGTCTGTGG - Exonic
915023580 1:152805196-152805218 AGCCAGAGCTCTGGGGTCTGTGG + Exonic
915024286 1:152812707-152812729 AGCCAGAGCTCTGGGGTCTGTGG - Exonic
915507872 1:156368925-156368947 GGGCACAGCTGTGGGACCTGGGG - Intergenic
916091328 1:161309893-161309915 TGCCCCAGCTATGGCTCCTGGGG - Exonic
916740050 1:167639817-167639839 AGCCTCAGCTCTGGGTCTCTTGG - Intronic
917845465 1:179016420-179016442 AGCCACAGTGCTGGGCCCTGAGG - Intergenic
917917925 1:179722847-179722869 AGGCACTGTTCTAGGTCCTGAGG + Intergenic
918402089 1:184173712-184173734 AGCCACTGCACATGGTCCTGTGG - Intergenic
918582322 1:186145785-186145807 AGCCAGTGCTCTGCCTCCTGTGG + Exonic
918844738 1:189594857-189594879 ACCCACAGCACTGTGTCCCGAGG - Intergenic
919135708 1:193505897-193505919 AGCCTGAGCTCTGCCTCCTGTGG + Intergenic
920404255 1:205697218-205697240 AGCCACATCTCTGGCTCCAGGGG + Intergenic
920750102 1:208666107-208666129 AGTCACAGCTCTGTGACCTTAGG - Intergenic
920915205 1:210253166-210253188 ACCCACACCTCTGGGTAATGGGG - Intergenic
921477955 1:215632951-215632973 AGGCACCGTTCTGGGTCCCGGGG + Intronic
921791404 1:219294706-219294728 TCCCACAGCTCAGGTTCCTGAGG + Intergenic
922467393 1:225853599-225853621 AGGCACAGCCCTGGGCCCAGGGG + Intronic
922546032 1:226457542-226457564 AGCCACAGCTCTGGTCTCGGTGG + Intergenic
922563478 1:226586217-226586239 AGCCACAGCTCAGGGACCTGGGG + Intronic
923359041 1:233189431-233189453 AGACACAGATCTGGGACGTGGGG + Intronic
924867930 1:248006199-248006221 AGCCACTGCTTGGGGTCCTGTGG + Intronic
1063177753 10:3567680-3567702 AGCCACATCCCTGGGATCTGAGG + Intergenic
1064286472 10:13995868-13995890 AGCCCCAGCTCTGGGTTGTCAGG - Intronic
1064337555 10:14457597-14457619 AGCCACAGGCCTGGGCTCTGGGG + Intronic
1065136571 10:22676721-22676743 AGGCACTGTTCTGGGTGCTGAGG + Intronic
1066242389 10:33550970-33550992 AGCAACAGCTATGGGGCCTCTGG - Intergenic
1066341658 10:34540223-34540245 AGACACTGTTCTAGGTCCTGGGG - Intronic
1067661678 10:48240777-48240799 GCACACAGCTCTGGGTCTTGTGG - Intronic
1067791199 10:49288964-49288986 GGCCACAGCACTGGCCCCTGGGG + Intergenic
1070350940 10:75591787-75591809 AGGCACAGTTCTAGGTGCTGGGG + Intronic
1070363749 10:75716059-75716081 AGCCCCAACAGTGGGTCCTGAGG - Intronic
1071508020 10:86244608-86244630 AGCCCCACCTCTGGCTCCAGCGG + Intronic
1071563158 10:86658451-86658473 AGCCCCTGCTCTGAGTCCTGGGG - Intronic
1071751963 10:88489461-88489483 AACCACAGCTCTGTGTGATGAGG + Intronic
1072122898 10:92419965-92419987 CCCCACAGCGCTGGGGCCTGAGG + Intergenic
1072611238 10:97018902-97018924 AGGCAGTGCTCTGGGCCCTGGGG + Intronic
1073073958 10:100811861-100811883 AGCCGCAGCTGTCAGTCCTGGGG - Intronic
1073802515 10:107057847-107057869 AGCCACTGCACTGCGGCCTGGGG - Intronic
1074288009 10:112116483-112116505 AGCCACTGCGCTGGGTCCTGAGG + Intergenic
1074349750 10:112724650-112724672 TGCCCCAGCTCTGGGGTCTGAGG - Intronic
1074406011 10:113180908-113180930 AGCCAAAGCCCTGGGCACTGTGG - Intergenic
1075612361 10:123864042-123864064 AGCCAGAGCCCAGGCTCCTGGGG - Intronic
1075676496 10:124299498-124299520 AGTCGCAGCCCAGGGTCCTGCGG - Intergenic
1076217807 10:128710418-128710440 AGCGGCAGGTCTGGGGCCTGGGG - Intergenic
1076899266 10:133329080-133329102 AGGCCCAGCTCAGGGTCCTCTGG - Intronic
1077518212 11:3015237-3015259 GGCCACAGCTCTGGGGCAGGGGG + Intronic
1077800022 11:5527926-5527948 AGCCAGAGCTTTGGGCACTGTGG + Intronic
1078379031 11:10823022-10823044 AGTCACAGGTCTGGGGCCTCTGG - Intronic
1078631608 11:13009232-13009254 AGCCACAGCTCTGGGCCTTGGGG + Intergenic
1078907116 11:15697854-15697876 TGCCACAGCTAAGGCTCCTGGGG + Intergenic
1080818377 11:35780887-35780909 AGGCACAGCTCTTGGTGCTGAGG + Intronic
1081245715 11:40764138-40764160 AGGCACTGCGCTGAGTCCTGAGG + Intronic
1081280942 11:41208860-41208882 GGCCACTGCTCAGGGTCCTGGGG + Intronic
1081525081 11:43922404-43922426 AGCCTCAGGGCTGGCTCCTGTGG + Intergenic
1081703315 11:45165353-45165375 AGCAACCGTTCTGGGTGCTGGGG + Intronic
1081765032 11:45604507-45604529 AGGCACAGCTCTGCTTCCTCAGG + Intergenic
1081863105 11:46345457-46345479 ATCCTCAGCTCTGGGCCCAGTGG + Intronic
1081873023 11:46391755-46391777 AGCCACAGCGCCGGGAGCTGCGG - Intergenic
1083844434 11:65322560-65322582 AGGCACGGCTCCGGGTGCTGGGG + Intergenic
1084386589 11:68846670-68846692 AGACTCAGCTCTGTGCCCTGTGG - Intergenic
1084515592 11:69636730-69636752 AGCCACGGCCCAGGGTCCGGCGG + Intergenic
1084531479 11:69730395-69730417 AGCCACAGCTCTGTGGCCTTAGG + Intergenic
1084787128 11:71448822-71448844 AGACACAGTTCTTGGTCCTAGGG + Intronic
1084868732 11:72081135-72081157 AGCCACCGCTCCCGGCCCTGGGG - Intronic
1085287876 11:75375822-75375844 AGGCACTGCGCTGGGTGCTGGGG - Intergenic
1086383407 11:86283519-86283541 AGGCACTGCTCTAGGTGCTGGGG - Intergenic
1086551832 11:88061673-88061695 AGGCACTTCTCTAGGTCCTGTGG - Intergenic
1088080960 11:105913149-105913171 AGGCACAGTTCTAGGCCCTGGGG + Intronic
1088494000 11:110414944-110414966 AGACACAGGTCTGGGTGCCGTGG - Intergenic
1088668629 11:112119608-112119630 AGGCACTGTGCTGGGTCCTGGGG + Intronic
1090087620 11:123664559-123664581 AGTCATAGCTTTGGGGCCTGGGG + Intergenic
1090271635 11:125389986-125390008 GGCCAGAGCTCTGGGCCCAGAGG + Intronic
1091296310 11:134476191-134476213 AGCACCAGCTCTGGCTGCTGTGG + Intergenic
1091384595 12:84973-84995 AGTCAGAGCTGTGGGTCCTCGGG + Intronic
1091749572 12:3014075-3014097 GGCCACAGCTGTGGGGCTTGGGG - Intronic
1092091289 12:5805659-5805681 AGCCCCATCTCTGTTTCCTGTGG + Intronic
1094577198 12:31697941-31697963 AGCCACAGCTTTTATTCCTGGGG + Exonic
1094830515 12:34298053-34298075 AGCCCCTGCACTGGGCCCTGGGG + Intergenic
1094832205 12:34305522-34305544 AGCCGCGGCTTGGGGTCCTGTGG + Intergenic
1094837020 12:34326846-34326868 AGCCCCTGCGCTGTGTCCTGGGG - Intergenic
1094874072 12:34621129-34621151 AGTCACAGCTATGGCTGCTGTGG - Intergenic
1095954524 12:47798591-47798613 TGCCGCAGCTCTTGTTCCTGGGG + Exonic
1096217915 12:49808723-49808745 AGCAGGAGCTGTGGGTCCTGAGG - Intronic
1096509971 12:52122229-52122251 AGCGTCAGATCTGAGTCCTGCGG - Intergenic
1096844720 12:54399877-54399899 AGCCGCAGCTCTGCTTCCTCGGG - Exonic
1097021581 12:56024769-56024791 AGCCTCAGCCCTGCTTCCTGTGG + Intronic
1097330074 12:58323452-58323474 AGGCACTGTTCTGGGTGCTGAGG - Intergenic
1099640329 12:85278046-85278068 AGCCTCAGCTCTGCGTTCTTTGG - Intergenic
1099993650 12:89753326-89753348 AGACATAGCTCTGGTTGCTGGGG + Intergenic
1100267322 12:92990025-92990047 GGCCAAAGCTCAGGGGCCTGGGG + Intergenic
1100677817 12:96887229-96887251 ATACACAGCTCTGAGGCCTGAGG - Intergenic
1100748215 12:97668660-97668682 AGCCACAGCTCTAGACACTGAGG + Intergenic
1100869358 12:98894687-98894709 AGCCACATGTCTGCGTCCTCGGG - Intronic
1101649863 12:106667611-106667633 TACCACAGTACTGGGTCCTGAGG + Intronic
1102184377 12:110936349-110936371 AGCCACGGTTCTTGGTGCTGGGG - Intergenic
1102462190 12:113106790-113106812 AGGCACAGTTCTAGGTGCTGGGG - Intronic
1104948217 12:132426924-132426946 AGACACTGCTCTAGGCCCTGGGG + Intergenic
1105658710 13:22469587-22469609 TGACACAGCTCTGGGTCGTGTGG + Intergenic
1106677894 13:31980919-31980941 AGGCACAGTGCTGGGCCCTGGGG + Intergenic
1107381154 13:39857576-39857598 TGGCATATCTCTGGGTCCTGGGG - Intergenic
1107644343 13:42478531-42478553 AGGCACTGGCCTGGGTCCTGGGG + Intergenic
1107669640 13:42731581-42731603 AACCACTGCTCAGGGTCCTTAGG - Intergenic
1107822203 13:44296136-44296158 AGCCACCTCCCTGGGTCCTGAGG + Intergenic
1107880903 13:44831199-44831221 AGGCACAGCTCTAGGCTCTGAGG - Intergenic
1108045436 13:46379418-46379440 TGCCACTGGTCTGGGTTCTGGGG - Intronic
1110369849 13:74727705-74727727 TCCCACAGCTATGGATCCTGAGG + Intergenic
1111406857 13:87818638-87818660 AGCCACAGATATGGAACCTGAGG - Intergenic
1112487819 13:99835700-99835722 AGGCACTGTTCTAGGTCCTGGGG - Intronic
1112598186 13:100829415-100829437 AGCCACAGGTATTGATCCTGTGG + Intergenic
1113948039 13:114055858-114055880 ACGCACAGCTCTGGGCCTTGCGG + Intronic
1113950011 13:114066527-114066549 AGCCACAGCTCAGGGCCAGGAGG + Intronic
1116819348 14:49612912-49612934 AGCCACTGCGCTGGGCCTTGAGG - Intronic
1117191524 14:53297106-53297128 AGGCACAGGTCTAGGTGCTGTGG + Intergenic
1119179695 14:72597435-72597457 GCCCACAGCCCTGGCTCCTGGGG - Intergenic
1119435193 14:74594076-74594098 AGTCCCAGCTCTGTGTCCTGGGG - Intronic
1119436133 14:74599174-74599196 AGTCCCAGCTCTGTGTCCTGGGG - Intronic
1119618606 14:76114862-76114884 AGCCACAGCTCTGGTTCCTCTGG - Intergenic
1119770978 14:77220605-77220627 AGCCACTGGTCTGGGAGCTGGGG + Intronic
1120033358 14:79667839-79667861 AGCCACAGCTCTAGGCCCCCTGG + Intronic
1120229002 14:81822519-81822541 AGACACAGCTCTGAATCCTAGGG - Intergenic
1120760723 14:88282521-88282543 AGCCTCAGCTTTGGGCCTTGAGG - Intronic
1120971876 14:90214554-90214576 ATCTACAGTTCTGGGACCTGGGG + Intergenic
1120984566 14:90322653-90322675 AGGCACAGGTCTAGGTACTGGGG + Intronic
1121018985 14:90567450-90567472 AGCCCCAGCTCTAGGTCTCGTGG - Intronic
1121204105 14:92147140-92147162 AGGCACAGTTCTGGGTGCTAGGG - Intronic
1121947877 14:98140366-98140388 AGCTACATCTCTGGGTCTTAAGG - Intergenic
1122188861 14:100023898-100023920 AGGCACTGTTCTGGGTCCAGAGG - Intronic
1122256673 14:100483130-100483152 AGCCAGTGCTCTGGGACATGGGG + Intronic
1122353463 14:101110550-101110572 AGCCACAGGTCTGACACCTGAGG - Intergenic
1122889334 14:104725161-104725183 AGGCCCAGCCCTGGGCCCTGGGG - Intronic
1123000792 14:105293064-105293086 AGCCACAACTTAGGGTTCTGGGG + Intronic
1123110663 14:105865494-105865516 ACCCACAGCCCGGGGTCCCGGGG + Intergenic
1202898526 14_GL000194v1_random:23224-23246 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1202904229 14_GL000194v1_random:59348-59370 AGCCACAGCCCTCTGCCCTGAGG - Intergenic
1123888434 15:24749909-24749931 AGTCACAGCTCTGGTTCAGGGGG - Intergenic
1125509290 15:40283989-40284011 AGCCAGAGCCCTGTGGCCTGGGG - Intronic
1128249865 15:66156485-66156507 AGCCACAGCTGGGGATCCAGTGG + Intronic
1128304851 15:66591614-66591636 AGCCACAGTTCTGGGCCCTGGGG + Intronic
1128421045 15:67491848-67491870 AGGCACAGTTCTAGGTGCTGGGG + Intronic
1128614031 15:69095481-69095503 AGCCAGAGCACTGAGTCCAGGGG - Intergenic
1129385205 15:75192478-75192500 TGCCTGAGCTCTGGGCCCTGAGG + Intergenic
1129412919 15:75359716-75359738 AGCCGCAGCCCTGTGTGCTGGGG - Exonic
1129500991 15:76037746-76037768 AGCCACAGCTGTGTTGCCTGGGG - Intronic
1129670775 15:77606569-77606591 AGCCCCAGCTCTGGGTGCTGCGG + Intergenic
1130409984 15:83639326-83639348 AGCTGCACCTCTGGGTCCAGTGG + Intergenic
1130607496 15:85331206-85331228 GGCCACAGCTCCGGAGCCTGAGG - Intergenic
1130902083 15:88214886-88214908 AGCCACTGCTCTAGGCACTGGGG - Intronic
1131230896 15:90658564-90658586 AGGCACTGTTCTAGGTCCTGAGG + Intergenic
1131231380 15:90662203-90662225 AGGCACTGTTCTAGGTCCTGAGG - Intergenic
1132633694 16:932261-932283 ATCCTCAGCGATGGGTCCTGTGG + Intronic
1132852952 16:2033060-2033082 CCCCTCAGCCCTGGGTCCTGGGG + Intronic
1132993133 16:2807686-2807708 AGCAAGAGCTCTGAGTCCTCTGG - Intergenic
1133021535 16:2969091-2969113 ACCCAACGTTCTGGGTCCTGCGG - Intronic
1133113586 16:3563870-3563892 GGCCACAGCTCTGCATCCTGGGG + Exonic
1133243078 16:4427595-4427617 AGCCACTGTTCTGGGCACTGAGG + Intronic
1133302870 16:4793621-4793643 AGCCACAGATGTGGAACCTGTGG - Intronic
1133928229 16:10211149-10211171 AGCCACAGCTCACAGGCCTGAGG + Intergenic
1134209537 16:12264494-12264516 AGCCACAGCACCCGGCCCTGTGG - Intronic
1134444905 16:14323342-14323364 AGACACAGTTCTAGGTGCTGAGG - Intergenic
1135876079 16:26201236-26201258 AGGCACTGTGCTGGGTCCTGGGG - Intergenic
1136508965 16:30724173-30724195 AGCCACCCCTCTGGCTCCTATGG + Exonic
1136545610 16:30953072-30953094 AGGCACAGTTCTAGGTCCTAGGG + Intronic
1139471919 16:67182965-67182987 AGGCACTGTTCTGGGTTCTGGGG - Intronic
1140028665 16:71315826-71315848 ACCAGCAGCTCTGGGCCCTGGGG + Intergenic
1140901058 16:79368256-79368278 AGCCACATCCCTGGCTCTTGAGG + Intergenic
1141183581 16:81771466-81771488 AACCTCAGAACTGGGTCCTGAGG - Intronic
1141467902 16:84219166-84219188 AGGCAGAGCTCTGCCTCCTGGGG - Exonic
1141589922 16:85061675-85061697 AGCCACAGCTCTGGTTGTTCCGG + Intronic
1141623508 16:85249492-85249514 AGCCAGAGCTCTGGGTTCCGGGG + Intergenic
1141894589 16:86950778-86950800 AGGCACAGTGCTGGATCCTGGGG - Intergenic
1142172965 16:88632398-88632420 AGCAGCAGCGGTGGGTCCTGGGG - Intergenic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1143728362 17:8865675-8865697 GGACAGAGCTCTGGGTCCTGAGG + Intronic
1144629921 17:16865875-16865897 AGCCAGAGTTCTGGGCACTGTGG - Intergenic
1144651509 17:17010242-17010264 AGCCAGAGTTCTGGGCACTGTGG + Intergenic
1144697054 17:17311949-17311971 AGCCACATGACTGTGTCCTGGGG + Intronic
1145060901 17:19733011-19733033 TGCCACAGCTCTGGGGCATCTGG - Intergenic
1145273891 17:21418736-21418758 AGCCTTAGCCCTGGGTACTGGGG + Exonic
1145830239 17:27910353-27910375 AGGCACTGCTCTGGGCTCTGGGG + Intergenic
1146004723 17:29154177-29154199 AACCACAGAACTGGGTTCTGTGG - Intronic
1147204080 17:38824399-38824421 AGCCACAGCGCCCGGCCCTGGGG - Intronic
1147239636 17:39082120-39082142 GGACACAGCTCTGGGCCCAGAGG - Intronic
1147397811 17:40158463-40158485 AGCCATAGCTCTGCCTCCTTAGG + Intronic
1148071788 17:44912785-44912807 AGACACCTCTCTGTGTCCTGGGG + Intronic
1148588055 17:48794890-48794912 AGTCACAGCTGCGGGACCTGGGG + Intronic
1151386332 17:73757547-73757569 CGCAGCAGCTCTGGTTCCTGGGG - Intergenic
1151546847 17:74798559-74798581 AGCCACAGAGCAGGGTGCTGGGG + Intronic
1151786964 17:76279742-76279764 TGTCTCAGCTCTGGGTACTGAGG + Intronic
1151821361 17:76498635-76498657 GGCCTCAGCTCTGGATACTGTGG - Intronic
1152276713 17:79362398-79362420 AGCCCCAGCTCTGAGGCATGGGG + Intronic
1152371528 17:79891442-79891464 AGACAGAGGTCTGGGTGCTGGGG - Intergenic
1152480513 17:80548656-80548678 AGCCACAGCACCTGGCCCTGGGG + Intronic
1152602775 17:81273292-81273314 GACCACAGCTGGGGGTCCTGGGG - Intronic
1152751510 17:82064634-82064656 AGCCACAGCAGTGATTCCTGTGG - Intronic
1152863569 17:82709535-82709557 AGCTACAGCTCCGGCTGCTGAGG - Intergenic
1153755106 18:8274778-8274800 AGTCACAGCTCTCTGTCCTCAGG + Intronic
1153823073 18:8848933-8848955 AGTCACAGCTCTGGGCCAGGTGG + Intergenic
1154287536 18:13074246-13074268 AGCTTGAGCTCTGTGTCCTGTGG + Intronic
1155990226 18:32272367-32272389 ACCCACAGCCCTGGTTACTGGGG + Intronic
1156136878 18:34051695-34051717 AGACACTGCTCTAGGTGCTGGGG + Intronic
1157816696 18:50734655-50734677 AGCCACTGCGCCTGGTCCTGTGG - Intergenic
1157864365 18:51168073-51168095 AGCCAGACCACTGTGTCCTGAGG - Intergenic
1158494815 18:57945443-57945465 TGTCATACCTCTGGGTCCTGGGG + Intergenic
1159577943 18:70202892-70202914 AGCTTCAGCTGTGGGTACTGCGG - Intronic
1160068890 18:75607176-75607198 AGGCAGAGCCCTGGGTCCTGGGG + Intergenic
1160450726 18:78964800-78964822 AGCCACAGGAGTGGCTCCTGGGG + Intergenic
1160483936 18:79270933-79270955 TGCCACAGCACCTGGTCCTGGGG + Intronic
1160708204 19:539651-539673 AGGCACGGCTCTGGGCTCTGGGG - Intronic
1160843554 19:1156967-1156989 AGGCAGGGCTGTGGGTCCTGAGG - Intronic
1160986924 19:1843339-1843361 AGCTGCGGCTCTGGGCCCTGGGG - Intronic
1161355741 19:3818872-3818894 AGCTCCAGCTCTGAGACCTGGGG + Intronic
1161420070 19:4171725-4171747 AGCCTCGGGTCGGGGTCCTGGGG - Exonic
1161479569 19:4503783-4503805 AGCCCCAGCTGTGGCTGCTGTGG + Exonic
1161488845 19:4550728-4550750 AGCCCCAGCCCTCGGCCCTGGGG + Intronic
1163154178 19:15431168-15431190 ACCCACAGGCCTGGGTTCTGAGG - Intronic
1164950203 19:32330702-32330724 ATCCACAGTGCTGGGTCCTGAGG + Intergenic
1165397429 19:35573033-35573055 AGTCACAGCTATGGCTGCTGTGG - Intergenic
1166253484 19:41586619-41586641 AGAACCAGCTCTGAGTCCTGAGG + Intronic
1166257889 19:41619218-41619240 AGAACCAGCTCTGAGTCCTGAGG - Exonic
1166287272 19:41838969-41838991 AGCAACAGCTCTGAATCTTGAGG + Exonic
1166410542 19:42553367-42553389 AGAACCAGCTCTGAGTCCTGAGG - Intronic
1166807371 19:45495415-45495437 AGGCACTGTTCTAGGTCCTGGGG + Intronic
1167312945 19:48747575-48747597 AGCCACCGCGCCGGGCCCTGAGG - Intergenic
1167429426 19:49446116-49446138 AGGGCCAGCTCTGGGGCCTGGGG + Intergenic
1167561153 19:50226799-50226821 AGCCGCAGCTCTGGGAGCAGTGG + Intronic
925008737 2:466667-466689 AGCCACAGCACCCGGCCCTGAGG + Intergenic
925453012 2:3987041-3987063 AGCCACAGCTTTGCTTTCTGTGG + Intergenic
925989840 2:9245840-9245862 AGGCACTGCTCTGGGCACTGGGG - Intronic
926208827 2:10853774-10853796 ACCCACAGCCCTGGGATCTGAGG - Intronic
926761056 2:16279490-16279512 AGCCACAGCTCTTGTTCCTGAGG + Intergenic
926782337 2:16484842-16484864 AGCTACTGCACTGGGTACTGAGG + Intergenic
927325522 2:21800859-21800881 AGCCACAGCTCTTAGCCCTAGGG + Intergenic
927485537 2:23486172-23486194 GGCCACAGCAGAGGGTCCTGGGG + Intronic
927519251 2:23689254-23689276 AGCCACAGCCATGCCTCCTGTGG + Intronic
927809983 2:26175382-26175404 AGGCCCAGCCCTGGGGCCTGGGG - Intronic
927868143 2:26606157-26606179 AGACACTGCGCTGAGTCCTGGGG + Intronic
928104018 2:28455994-28456016 AGCCACTGCTTTGGGCACTGGGG + Intergenic
928252595 2:29694934-29694956 AGGACCAGCTCTGGTTCCTGAGG + Exonic
928314934 2:30237700-30237722 AGCCCCAGCTACTGGTCCTGGGG + Intronic
928393825 2:30929264-30929286 AGCCACAGCCTTGGGCCCTGCGG + Intronic
932104794 2:68932593-68932615 AGCTACAGCTCTGCCTGCTGTGG - Intergenic
932104806 2:68932652-68932674 GACCACAGCACTGGGTCCTCTGG + Intergenic
932106080 2:68944073-68944095 AGCCACAGCCCTGGGACGTCCGG + Intergenic
932334209 2:70920587-70920609 ATCCACAGACCTGGGACCTGGGG - Intronic
934174494 2:89567002-89567024 AGGAAGAGCTCAGGGTCCTGTGG + Intergenic
934284810 2:91641352-91641374 AGGAAGAGCTCAGGGTCCTGTGG + Intergenic
934300444 2:91773317-91773339 AGCCCCCGTTCAGGGTCCTGGGG - Intergenic
934502410 2:94871049-94871071 AGCCACAGCCCTCTGCCCTGAGG + Intergenic
936087973 2:109482445-109482467 AGCCACAGCACGGTGTTCTGCGG - Intronic
936096206 2:109532108-109532130 ATTCACAGCTCTGTGTCCTTTGG - Intergenic
936247445 2:110840803-110840825 AGCCTCAGCTCTGAGCTCTGAGG - Intronic
937292563 2:120790467-120790489 AGCCTCCACTCTGGGTCCTTTGG - Intronic
937358776 2:121214516-121214538 AGCCACAGCTCTGGGCGCCATGG + Intergenic
937710711 2:124977362-124977384 GGCCAAATCTCTGGGTCTTGAGG - Intergenic
937894012 2:126963614-126963636 AGCCACAGCTGTGGTTCTGGTGG + Intergenic
938292171 2:130156119-130156141 AGCCACATCTCCAGGACCTGTGG + Exonic
938342397 2:130544299-130544321 GGCCCCTGCTCTGGGCCCTGAGG - Intronic
938347435 2:130576410-130576432 GGCCCCTGCTCTGGGCCCTGAGG + Intronic
938464381 2:131516851-131516873 AGCCACATCTCCAGGACCTGTGG - Intergenic
938489551 2:131754604-131754626 AGCCCCTGCGCTGGGCCCTGGGG + Intronic
938668111 2:133560303-133560325 AGCCACTGTTCTAGGTCCTAAGG + Intronic
940323203 2:152399116-152399138 AGCACCAGCTCAGGGTCCAGGGG - Intronic
942595587 2:177589072-177589094 AGACACAGCTCTGGTTCAAGAGG + Intergenic
946434320 2:219641818-219641840 AGGCACATCTCTGGGTCCTGAGG - Exonic
947800029 2:232923448-232923470 AGCCACTGCACTGGGCCTTGTGG - Intronic
948738989 2:240030720-240030742 ACCCAAAGCTCTGAGTCCAGGGG + Intergenic
948845820 2:240682381-240682403 AGCTGCAGCTCTGGGCCATGAGG + Exonic
948848037 2:240692349-240692371 AGCTGCAGCTCTGGGCCATGAGG - Exonic
1168796456 20:612932-612954 AGGCACAGTTCTGGGTACTGCGG + Intergenic
1168848588 20:961460-961482 AGCCACAGCCCTGACTCTTGGGG - Intronic
1170787944 20:19483674-19483696 AGGCTCAGCTAAGGGTCCTGAGG + Intronic
1171343819 20:24450972-24450994 GGCCACTGCTCTGGCTGCTGAGG + Intergenic
1172607261 20:36222387-36222409 AGCCACAGGTAAGGCTCCTGAGG + Exonic
1173814964 20:45981375-45981397 AGTCACTGCTCTGGGGCCTCAGG - Intergenic
1173967921 20:47127690-47127712 AGACACAGCTCTGAGCCCTTGGG - Intronic
1174235656 20:49089009-49089031 AGTTACAGCTCTGGGATCTGAGG + Intronic
1174359680 20:50020232-50020254 AGCCACAGCTCTAGGGCCCCTGG + Intergenic
1175113800 20:56667588-56667610 AGACACTGTTCTGGGTGCTGAGG + Intergenic
1175387754 20:58608231-58608253 AGCCCCTGCTTTGGGGCCTGTGG - Intergenic
1175389624 20:58618819-58618841 AGCCACAGAGCTGGCTCCAGAGG + Intergenic
1175477297 20:59285909-59285931 AGCAACAGCTCAGAGTTCTGTGG + Intergenic
1175546832 20:59783706-59783728 AGGCACTGCCCTGGGTGCTGTGG + Intronic
1176510407 21:7743950-7743972 AGTCCCAGCTCTGGTACCTGCGG + Intergenic
1176618208 21:9039214-9039236 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1176706205 21:10121324-10121346 AGCTCCTGCTCTGGGCCCTGTGG + Intergenic
1176706633 21:10123244-10123266 AGCCCCTGCGCTGGGCCCTGGGG + Intergenic
1177843678 21:26263252-26263274 AGCCCCAGCTCTTTGTCCAGAGG + Intergenic
1178144966 21:29728685-29728707 AGGCACTGCTCTGGGCCCTAGGG + Intronic
1178482910 21:32995763-32995785 AGGCACTATTCTGGGTCCTGGGG - Intergenic
1178499555 21:33114570-33114592 AGCTGCAGTTCTGGGACCTGGGG - Intergenic
1178644520 21:34374479-34374501 AGTCCCAGCTCTGGTACCTGCGG + Intergenic
1179202333 21:39236305-39236327 AGCAGGAGCTCTGGGGCCTGTGG - Intronic
1179444922 21:41424473-41424495 TGCCCCAGCTTTAGGTCCTGGGG - Intronic
1179548227 21:42126259-42126281 GGCCACGGCTCTAGGTGCTGGGG - Intronic
1179974945 21:44859607-44859629 AGACACAGCTCCTGGACCTGGGG - Intronic
1180195915 21:46194318-46194340 AGCCACATGCCTGGTTCCTGGGG - Intronic
1180232279 21:46434369-46434391 AGGCTCAGCTGTGGGTCCTCTGG + Intronic
1180608730 22:17081859-17081881 AGCCACTGCTCTGGGCCCCCAGG - Intergenic
1180906856 22:19419665-19419687 AGCCACAGCTCTGGGTCCTGAGG - Intronic
1180965057 22:19783859-19783881 AGCCACAGCTCGCTGACCTGGGG + Exonic
1181035545 22:20168243-20168265 AGTCCCAGCTCTGTGTTCTGGGG + Intergenic
1181111679 22:20606260-20606282 AGCCACACCTCCAGGACCTGTGG + Intergenic
1181364996 22:22369605-22369627 AGCCCCAGCTCTGGCACCAGGGG + Intergenic
1181368061 22:22395009-22395031 AGCCCCAGCTCTGGCGCCAGGGG + Intergenic
1181698799 22:24608450-24608472 AGCCCCCGGTCAGGGTCCTGGGG - Intronic
1181816036 22:25437565-25437587 AGCCACTGCTCAGGGTGCAGGGG + Intergenic
1183214635 22:36471462-36471484 AGGCACAGTGCTGGGTGCTGCGG + Intronic
1183357291 22:37366617-37366639 AGCCCCAGCTGAGGGGCCTGAGG + Intergenic
1183888504 22:40905441-40905463 AGGCACTGCTCTGGGTTCTGAGG + Intronic
1184294616 22:43515648-43515670 GGCCCCGGCTCTGGCTCCTGAGG + Intergenic
1184723370 22:46328952-46328974 AGCCACAGCCCTGGGTTCCACGG - Intronic
1184734477 22:46390149-46390171 AGACACAGAGCTGGGTCCTCTGG + Intronic
1184741805 22:46432856-46432878 ACCCAGAGCTCTGGGTCGGGGGG - Intronic
1184855000 22:47142049-47142071 TGCCACAGCTCTGGCCCCTGTGG + Intronic
1185181735 22:49367491-49367513 AGCCACGCCTCTGGTGCCTGTGG - Intergenic
1185268750 22:49918722-49918744 AGCCGGAGCTCCAGGTCCTGCGG - Exonic
949297546 3:2543439-2543461 AGCCAGAGCTCTGGGTCACCTGG + Intronic
950429404 3:12942196-12942218 AGGCACTGCTCTGGGCTCTGGGG - Intronic
950680231 3:14580149-14580171 AGCACCTGCTCTGGGTGCTGGGG - Intergenic
951051866 3:18102699-18102721 AGGCACAGCCCTAAGTCCTGGGG + Intronic
951803660 3:26623614-26623636 CCCCGCAGCTCTGGCTCCTGAGG + Intronic
952342533 3:32457982-32458004 GGCCAGAGCTCTGGGGCCTGGGG + Intronic
953021996 3:39120558-39120580 CTCCACAGTTCTGGTTCCTGGGG - Intronic
953117533 3:40007973-40007995 ACCCACATATCTGGGTACTGTGG + Intronic
953259526 3:41324055-41324077 AGCCCAAGCTCAGGGTTCTGAGG + Intronic
953390597 3:42531628-42531650 AACCACAGCTCTCGGGCCAGAGG + Intronic
954289179 3:49640177-49640199 AGCCTCAGCTCTGGTTGATGAGG + Intronic
954291776 3:49653695-49653717 AGCCACAGCTGTGGTGGCTGGGG - Exonic
954353480 3:50065144-50065166 AGCCCCAGCCCTAGGTCCAGGGG - Intronic
955043469 3:55338223-55338245 AGCCATAACTCTGGATCCTGAGG - Intergenic
955346738 3:58167234-58167256 AGCAGCAGCTCTGAGGCCTGGGG - Intronic
955656549 3:61250997-61251019 CGCCACAGCTCTTGGCTCTGGGG - Intronic
956463913 3:69500114-69500136 AGCCACAGCTCTGGGTCCTGGGG - Intronic
957368227 3:79254831-79254853 AGACACAGCTCTGAGAACTGAGG - Intronic
957400556 3:79707323-79707345 GGACATAACTCTGGGTCCTGTGG - Intronic
957682800 3:83459496-83459518 AGCCCAAGCTGTGGGTCCAGAGG + Intergenic
960253108 3:115479176-115479198 AACCAAAGCTCTGTGTGCTGGGG + Intergenic
960592320 3:119378229-119378251 TGCCCCAGCTGTGGGTTCTGTGG + Intronic
961022570 3:123521390-123521412 AGGGACAGCTCTGAGTCCTAGGG + Intronic
961385125 3:126518816-126518838 AGCCAGACCTCTGGGTCCTCAGG - Intergenic
961509639 3:127392956-127392978 AGACACATCTCTGGGTCCCCAGG - Intergenic
962256137 3:133871508-133871530 ACCCACAGCTTTGGGGCCAGTGG + Intronic
962357698 3:134709019-134709041 GCCCACAGCTCAGTGTCCTGTGG + Intronic
962487651 3:135860691-135860713 AGCCACTACACTGGGTTCTGGGG - Intergenic
962884396 3:139610695-139610717 AGCCCCAGTTCTGGGTCTTCTGG - Intronic
962958676 3:140290256-140290278 AGGCACAGCACTGAGCCCTGGGG + Intronic
965468100 3:169057606-169057628 AGGCACAGTTCTGGGTAATGAGG + Intergenic
968490335 4:886751-886773 AGCCACAGCCCTGGGCCCAGTGG + Intronic
968505467 4:969171-969193 AACCACACCCCCGGGTCCTGGGG + Intronic
968509660 4:989929-989951 AGCCTGGGCTCTGGGACCTGAGG + Exonic
969106005 4:4807544-4807566 TGCCACAGGTCTGGTTCCTTGGG + Intergenic
969324354 4:6432301-6432323 GGCCACAGCTCTGCCTTCTGGGG + Intronic
969724186 4:8909511-8909533 AGCCACCGCTCTGGGCCCAGGGG + Intergenic
969847683 4:9932347-9932369 AGGCACTGCTCTAGGTGCTGGGG + Intronic
969891108 4:10260831-10260853 TGTCACAGCTCTGGTTCATGTGG - Intergenic
971621732 4:28863096-28863118 ATCCACAGATATGGGACCTGCGG - Intergenic
972277037 4:37566865-37566887 AGCCACCGCGCCTGGTCCTGAGG + Intronic
972598863 4:40554084-40554106 AGGCACCGTGCTGGGTCCTGGGG - Intronic
972732486 4:41808612-41808634 AGGCACAGTGCTGGGCCCTGGGG - Intergenic
973816272 4:54622358-54622380 AGCCAAAGTCCTGGGCCCTGTGG - Intergenic
973835028 4:54801040-54801062 AGCCCCAGCTCTGGGTGATGCGG + Intergenic
974494549 4:62609659-62609681 AGCCAGAGCTCTGGACCCGGGGG + Intergenic
976198478 4:82556990-82557012 GGCCAGAGCTCAGGGTCCTGGGG - Intronic
976213175 4:82692239-82692261 AACCACTGCCATGGGTCCTGAGG + Intronic
976597271 4:86906004-86906026 AGCCACCGCTCCTGGCCCTGAGG + Intronic
978018875 4:103784468-103784490 TGACATAGCTCTGGGTTCTGAGG + Intergenic
979524119 4:121699083-121699105 AGGCACAGATCTAGGTGCTGGGG + Intergenic
979751941 4:124289985-124290007 ATTCACTGCTCTGTGTCCTGGGG + Intergenic
979924542 4:126544731-126544753 AGCCACTGCTCTAAGTGCTGTGG - Intergenic
980092925 4:128460990-128461012 AGAGACTGCTCTTGGTCCTGGGG - Intergenic
981057163 4:140374408-140374430 GGGCACAGCTTTGGGTCCTCGGG - Intronic
981569465 4:146136197-146136219 AGCCACGGCTGTAGGTGCTGTGG + Intergenic
982043737 4:151420881-151420903 TGAGAGAGCTCTGGGTCCTGTGG - Intronic
984624399 4:181989262-181989284 AGGAGCAGCTCTGTGTCCTGAGG + Intergenic
984704346 4:182836847-182836869 AGCCACAGCCCTGGCCCCTCAGG + Intergenic
985529478 5:425238-425260 GGCAACAGATCTGGGGCCTGTGG - Intronic
985627719 5:998531-998553 AGCCAAAGCTCCGGCTCCTTGGG - Intergenic
988289327 5:29265542-29265564 ATCCACAGATTTGGATCCTGTGG - Intergenic
988488627 5:31688617-31688639 ACACACATATCTGGGTCCTGGGG + Intronic
988546170 5:32159852-32159874 AGTCACAGCTCTGGGGCTCGAGG - Intronic
988594181 5:32575880-32575902 AGCCAGATCTCTGGGTCCTTTGG - Intronic
989836613 5:46001601-46001623 AGTCACAGCTATGGCTGCTGTGG - Intergenic
991001745 5:61789916-61789938 AGGCCCCGCTCTGGGACCTGGGG - Intergenic
991550917 5:67835019-67835041 AATCACAGCACTGGGTCCTCAGG + Intergenic
991638844 5:68733482-68733504 TGCCAATCCTCTGGGTCCTGTGG + Intergenic
994077478 5:95669626-95669648 AGGAAGAGCTCTTGGTCCTGTGG + Intronic
995321764 5:110842677-110842699 ATCCACAGATGTGGGACCTGTGG - Intergenic
997039633 5:130236237-130236259 ATCCACAACTCTGCCTCCTGGGG - Intergenic
997209617 5:132069716-132069738 AGCAACATCTCTGGCTTCTGCGG - Intergenic
997435113 5:133868217-133868239 AGGCACAGTGCTGGGTGCTGAGG + Intergenic
997634490 5:135394919-135394941 AGCCATAGCTCCCAGTCCTGTGG - Intronic
997654828 5:135546982-135547004 AGCTCCAGCTCTGGGCACTGTGG + Intergenic
998567534 5:143229597-143229619 AGCCAGCGCTCTGGGGACTGAGG + Intergenic
999136811 5:149326014-149326036 AGTCACTGCTCTGGATCCAGGGG - Intronic
999654550 5:153799287-153799309 GACCACAGCTCTGGTTCCTCTGG - Intronic
999888828 5:155954648-155954670 AGACACTACTCTAGGTCCTGGGG - Intronic
1001276409 5:170354718-170354740 AGACACAGGACTGGGCCCTGAGG - Intronic
1001960050 5:175874455-175874477 AGACACTGTTCTGGGTGCTGGGG - Intronic
1002932470 6:1644034-1644056 AGTCACAGCGCTGGGCCCTGGGG - Intronic
1002935008 6:1663963-1663985 AGGCACTGCTCTGGGTCCTGAGG - Intronic
1003965366 6:11247604-11247626 TGCCAGAGGTCTGGGGCCTGGGG - Intronic
1004139211 6:13000260-13000282 AGCCACAGCACAGGGTCATCCGG - Intronic
1004148023 6:13088335-13088357 AAGCACAGCTCTGAGTACTGAGG - Intronic
1005338560 6:24821469-24821491 AGCCACAGAGCTGGGCACTGTGG - Intronic
1006152499 6:31996915-31996937 ATCCACAGGGCTGGGGCCTGGGG - Exonic
1006158805 6:32029652-32029674 ATCCACAGGGCTGGGGCCTGGGG - Exonic
1006757721 6:36431356-36431378 AGGCACTGCTCTGGACCCTGGGG + Intronic
1006860799 6:37170507-37170529 AGCCCCGGCTCCGGCTCCTGCGG + Exonic
1007596836 6:43056168-43056190 AGACATAGCTCTGGTTGCTGGGG - Exonic
1007740609 6:44007262-44007284 AGGCACGGCTCTGGGCACTGAGG + Intergenic
1007822307 6:44569704-44569726 AGTCACTGTACTGGGTCCTGGGG - Intergenic
1007921828 6:45617221-45617243 AGGCACAGATCTAGGTGCTGTGG + Intronic
1008025226 6:46628602-46628624 AGCCTGAGCTCTGAGTCCTATGG + Intronic
1014363902 6:120516211-120516233 AACCAAATCTGTGGGTCCTGTGG - Intergenic
1014711579 6:124812411-124812433 AGACACTGTTCTGGGTTCTGAGG + Intronic
1016454350 6:144215684-144215706 AGCCTGGGCTCTGGGTTCTGTGG + Intergenic
1017766100 6:157608593-157608615 AGCCACACCTCTGGTCCCTCGGG - Intronic
1018639657 6:165894852-165894874 AGCCACTGCTCTGGCTAATGAGG - Intronic
1019029522 6:168998457-168998479 AGCCACTGTTCTGTGTTCTGAGG - Intergenic
1019337833 7:493734-493756 AGCCCCAGGTGTGGGGCCTGGGG - Intergenic
1019351047 7:554104-554126 GGGCACAGCTCTGGGCTCTGAGG + Intronic
1019428817 7:989139-989161 AGCCCCAGCTGTAGGTGCTGGGG - Exonic
1019560006 7:1651205-1651227 AGATACAGCCCTGGGTCCTCAGG + Intergenic
1019696006 7:2446510-2446532 AGCCGCAGCGCTGAGCCCTGAGG - Intergenic
1019710123 7:2514354-2514376 AGGCACTGCTCTAGGCCCTGGGG + Intronic
1019736078 7:2650288-2650310 AGCCAGAGGTCTGGGTGCAGTGG + Intronic
1022046581 7:26626856-26626878 AAAAACAGCCCTGGGTCCTGTGG + Intergenic
1022056916 7:26746209-26746231 AGTCACAGCTCTGGGAACAGAGG - Intronic
1022595408 7:31708913-31708935 AGCCACAGCTTTGGGTAGAGGGG + Intergenic
1023860795 7:44216743-44216765 AGCCAGAGGTCTTGGTCCTGGGG + Intergenic
1024000538 7:45186494-45186516 AGCCACAGCCCTGCCTCATGGGG + Intergenic
1024042980 7:45569118-45569140 ACCCACCGCTCTGGGGTCTGGGG - Intergenic
1024118056 7:46211498-46211520 TGCCACAGCCCTGCGGCCTGGGG + Intergenic
1026102723 7:67396204-67396226 GGCCACAGTTCAGGGGCCTGGGG - Intergenic
1026883447 7:73921778-73921800 AGCCATATCTCTCTGTCCTGGGG + Intergenic
1027848788 7:83422233-83422255 AGCCACACCTTTGGGTCAGGAGG - Intronic
1028812427 7:95102886-95102908 ACCCACATATCTGGGTACTGTGG - Intronic
1029999995 7:105049516-105049538 AGCTACTGTTTTGGGTCCTGGGG + Intronic
1033030579 7:137822119-137822141 AGCCACCGCTCTGTGCCCTGAGG - Intronic
1033544313 7:142386118-142386140 AGCCCCAGCTCACAGTCCTGAGG + Intergenic
1034318561 7:150157843-150157865 AGGCACAGCGCTGGGTCATAGGG + Intergenic
1035344646 7:158190237-158190259 ACCCACTGCTCTGGGGCCAGGGG - Intronic
1035731126 8:1854154-1854176 AGACACTGCCCTGGGCCCTGGGG - Intronic
1035732691 8:1863963-1863985 AGTCACAGCCGTGGCTCCTGTGG + Intronic
1036122951 8:6037855-6037877 AACCACAGCACTGGGGCTTGAGG + Intergenic
1036182999 8:6601021-6601043 AGCCTCAGCTCTCCTTCCTGGGG - Intronic
1036560662 8:9898431-9898453 GGACACGTCTCTGGGTCCTGGGG + Intergenic
1037573621 8:20179951-20179973 AGCCTCAGCTCTGGGACCCCTGG + Intronic
1038161996 8:25048451-25048473 AACCACATCTTTGGTTCCTGAGG + Intergenic
1038425796 8:27463084-27463106 AGCCTCAGCCTTGGGACCTGAGG + Exonic
1039430444 8:37521429-37521451 GCCCACAGCCCTGTGTCCTGGGG + Intergenic
1040834869 8:51721087-51721109 AGCCAAAGCTCTGAGTCTTGGGG - Intronic
1041661963 8:60409634-60409656 AGCCAATGGTCTGGGTACTGCGG - Intergenic
1043153123 8:76743531-76743553 ACTCCCAACTCTGGGTCCTGGGG + Intronic
1044434595 8:92147280-92147302 AGCCACTGTCCTGGGTCTTGGGG + Intergenic
1046169815 8:110490690-110490712 AGCCACTGCTCTGCAGCCTGGGG - Intergenic
1046810260 8:118525481-118525503 AGACACTGCTCAGGGTGCTGGGG - Intronic
1048658992 8:136575072-136575094 TGCCCCAGCTCTGGGTGCTCTGG + Intergenic
1049203620 8:141353296-141353318 CGCCCCAACTCTGTGTCCTGCGG - Intergenic
1049466195 8:142752263-142752285 AGCCAGAGCTGTGGGGCCGGGGG - Intronic
1049664045 8:143835297-143835319 AACCCCAGCTCTGGGGCTTGGGG - Exonic
1049795733 8:144496546-144496568 AGCCTCACCCCTGGGCCCTGGGG + Exonic
1049865769 8:144934493-144934515 AGCCCCAGCCCTGGCTCCAGAGG + Intronic
1050446765 9:5731211-5731233 AGGCACTGCTCTAGGTGCTGAGG - Intronic
1050600491 9:7245535-7245557 AGCCACCTCTCTGTGGCCTGTGG + Intergenic
1052809068 9:33040959-33040981 AGGGCCAGCTCTGGGTCATGTGG - Intergenic
1053643490 9:40108441-40108463 AGCTCCTGCTCTGGGCCCTGTGG + Intergenic
1053643928 9:40110364-40110386 AGCCCCTGCGCTGGGCCCTGGGG + Intergenic
1053762224 9:41355125-41355147 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1053762661 9:41357049-41357071 AGCTCCTGCTCTGGGCCCTGTGG - Intergenic
1054324345 9:63705669-63705691 AGCTCCTGCTCTGGGCCCTGTGG + Intergenic
1054540821 9:66266245-66266267 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1054541262 9:66268163-66268185 AGCTCCTGCTCTGGGCCCTGTGG - Intergenic
1054952885 9:70872765-70872787 TGCCACAGTTCTAGGTGCTGGGG - Intronic
1055407162 9:75987241-75987263 AGCCTCAGGTGTGGGTTCTGAGG - Intronic
1056707794 9:88966865-88966887 GGCCCCAGCTCTGGGTCCTGGGG + Intergenic
1056751758 9:89357007-89357029 AGGCACAGGTCTGGCTCCCGAGG - Intronic
1057031000 9:91775240-91775262 AGCCACAGGTCTGCATCCGGGGG + Intronic
1057171329 9:92965014-92965036 AGGCACAGCACGGGGTGCTGAGG - Intronic
1058544992 9:106051916-106051938 CGCCACAGCCCTGGGATCTGAGG + Intergenic
1058801122 9:108545291-108545313 TGCCACAGCTCTGTGCACTGTGG + Intergenic
1058993624 9:110278389-110278411 AGCCACACTTCTGGGCACTGAGG + Intergenic
1059324149 9:113493452-113493474 GGCCTCAGCTCTGGGCCATGGGG + Intronic
1059407745 9:114112377-114112399 AGCCACTGTTCTGGCCCCTGTGG + Intergenic
1059886194 9:118747260-118747282 AGCCACAGCTCCCAGCCCTGAGG + Intergenic
1060402014 9:123354819-123354841 TGCCACAGCCCTGGGTCCCCAGG - Intergenic
1060749529 9:126159825-126159847 ATCCACAGCTCGGTTTCCTGGGG + Intergenic
1061083691 9:128386998-128387020 AGCCACATTTCTGTGTGCTGTGG + Intronic
1061221989 9:129257633-129257655 AGGCCCTGCTCTGGGCCCTGGGG + Intergenic
1061429847 9:130524008-130524030 AGCCGCAGCCCTGACTCCTGGGG + Intergenic
1062496049 9:136832182-136832204 ACCCACAGCTGTGGGCCCAGGGG + Intronic
1062552465 9:137095907-137095929 AGCAACACCTCTGGGTCCCCAGG - Intronic
1062702962 9:137917621-137917643 AGCCTCAGCTCAGACTCCTGAGG + Intronic
1202791240 9_KI270719v1_random:91412-91434 AGCTCCTGCTCTGGGCCCTGTGG + Intergenic
1203746784 Un_GL000218v1:44543-44565 AGCCACAGCCCTCTGCCCTGAGG - Intergenic
1203563322 Un_KI270744v1:74937-74959 AGCCACAGCCCTCTGCCCTGAGG + Intergenic
1186179515 X:6959365-6959387 AGCCACAGCTGGGGCACCTGAGG - Intergenic
1187237925 X:17485623-17485645 AGCATCAGCTCTGGGTGGTGGGG + Intronic
1187273796 X:17801495-17801517 AGCCCCAGCTCCTGGACCTGAGG - Exonic
1188550528 X:31359697-31359719 AGGCACTGACCTGGGTCCTGGGG - Intronic
1189483395 X:41410368-41410390 AGGCACAGTTCTGGGAGCTGGGG + Intergenic
1190338320 X:49276753-49276775 AGCCTCAACTCTGGGACTTGCGG - Intronic
1190432813 X:50394150-50394172 AGCCACAGCTCCGAGGTCTGGGG - Intronic
1191257966 X:58287943-58287965 AGCCACTGCACTGGGCCCAGGGG + Intergenic
1192181131 X:68916470-68916492 AGCCCCTGCACTGGGTCCTGGGG - Intergenic
1192793950 X:74411428-74411450 AGCCACAGACCTAGGGCCTGAGG - Intergenic
1193883805 X:86960353-86960375 AGCCAATGCTCTGGCTTCTGTGG + Intergenic
1194895054 X:99430404-99430426 GGCCATAGCTCTGGGGTCTGGGG - Intergenic
1197186271 X:123590633-123590655 AGACACTGCACTTGGTCCTGGGG - Intergenic
1198394164 X:136206343-136206365 AGCCACTGCTCAGGGTGCTGGGG + Intronic
1199108952 X:143907614-143907636 AGCTAAAGCTCATGGTCCTGTGG - Intergenic
1199496165 X:148454890-148454912 AGGCACTGTTCAGGGTCCTGGGG + Intergenic
1201038599 Y:9807121-9807143 ATCCACACCTCTGGGGTCTGAGG + Intergenic
1201151597 Y:11098051-11098073 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1201160112 Y:11159557-11159579 AGCCACAGCCCTCTGCCCTGAGG - Intergenic