ID: 1180910452

View in Genome Browser
Species Human (GRCh38)
Location 22:19446715-19446737
Sequence GAGGGAGACCTGTCTCAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180910452_1180910458 -8 Left 1180910452 22:19446715-19446737 CCCCCCTGAGACAGGTCTCCCTC No data
Right 1180910458 22:19446730-19446752 TCTCCCTCTGTTATCCAGGCTGG 0: 7
1: 600
2: 13751
3: 123403
4: 244220
1180910452_1180910461 2 Left 1180910452 22:19446715-19446737 CCCCCCTGAGACAGGTCTCCCTC No data
Right 1180910461 22:19446740-19446762 TTATCCAGGCTGGTGTGCAGTGG 0: 4
1: 403
2: 15226
3: 181702
4: 309530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180910452 Original CRISPR GAGGGAGACCTGTCTCAGGG GGG (reversed) Intronic
No off target data available for this crispr