ID: 1180913874

View in Genome Browser
Species Human (GRCh38)
Location 22:19471937-19471959
Sequence TGCACTGTGCTCTCACAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 291}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180913874_1180913880 -3 Left 1180913874 22:19471937-19471959 CCCCTCTGTGAGAGCACAGTGCA 0: 1
1: 0
2: 4
3: 46
4: 291
Right 1180913880 22:19471957-19471979 GCACGGCTCAAGGAGGAACCTGG 0: 1
1: 0
2: 0
3: 11
4: 110
1180913874_1180913879 -10 Left 1180913874 22:19471937-19471959 CCCCTCTGTGAGAGCACAGTGCA 0: 1
1: 0
2: 4
3: 46
4: 291
Right 1180913879 22:19471950-19471972 GCACAGTGCACGGCTCAAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 171
1180913874_1180913881 5 Left 1180913874 22:19471937-19471959 CCCCTCTGTGAGAGCACAGTGCA 0: 1
1: 0
2: 4
3: 46
4: 291
Right 1180913881 22:19471965-19471987 CAAGGAGGAACCTGGCAACTTGG 0: 1
1: 0
2: 1
3: 13
4: 170
1180913874_1180913883 19 Left 1180913874 22:19471937-19471959 CCCCTCTGTGAGAGCACAGTGCA 0: 1
1: 0
2: 4
3: 46
4: 291
Right 1180913883 22:19471979-19472001 GCAACTTGGTAACACAGCACTGG 0: 1
1: 0
2: 1
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180913874 Original CRISPR TGCACTGTGCTCTCACAGAG GGG (reversed) Intronic
900554455 1:3272805-3272827 TGCCCTGTGCCCCCACAGGGAGG + Intronic
900971462 1:5994362-5994384 GGCCCTGTGCTCTCGCAGTGTGG + Intronic
904168140 1:28571957-28571979 GGCACTGTGCTCTCAGCTAGAGG + Intronic
904533732 1:31185442-31185464 TACACTGTGCTCTCTGAGTGAGG - Intronic
905516375 1:38564914-38564936 AGCACTGAGAGCTCACAGAGAGG + Intergenic
905769821 1:40630249-40630271 TTCACTGTACTCCCACAGAATGG + Intronic
907612524 1:55886874-55886896 TGCCTTGTGCTCTGACTGAGGGG + Intergenic
908935487 1:69371314-69371336 TGCACTGTGATCTTAGAGAGTGG + Intergenic
909231630 1:73099473-73099495 TGCATACTGCTCTCAAAGAGAGG + Intergenic
912283393 1:108341562-108341584 TGCACTGTGCTCTGACAGTGTGG - Intergenic
913269965 1:117083577-117083599 AGCAATGTGCTTTCACAGAGTGG - Intronic
915116933 1:153607287-153607309 AGCATTGAGATCTCACAGAGGGG + Exonic
915817483 1:158984491-158984513 TGCACTGTGATCTGAGAGTGTGG + Intergenic
915975831 1:160387946-160387968 TGCACTGTGGTCTGAGAGACAGG + Intergenic
919608135 1:199711747-199711769 TGCACTGTGGTCCAACAGAGTGG - Intergenic
919852102 1:201679761-201679783 TGCACTCTGCTCTCTCAGGGAGG + Intronic
920157239 1:203963885-203963907 TGCACTGTGTTCTCTCAAAGAGG - Intergenic
920441980 1:205986837-205986859 TGCACTGTGTTCTGGGAGAGGGG - Intronic
920709637 1:208282722-208282744 TGGTCAGTGCTCTAACAGAGAGG + Intergenic
921076558 1:211704647-211704669 AGCACAGTGCTCTCAAAGGGTGG + Intergenic
921927808 1:220726980-220727002 TGCACAGTGATCTAACAGAGTGG - Intergenic
923263555 1:232290219-232290241 TCAACTGTGCTCTCCCAGAGAGG + Intergenic
923965005 1:239127634-239127656 CTCACTGTGTCCTCACAGAGTGG - Intergenic
1063874245 10:10455658-10455680 TTCTCTGCGTTCTCACAGAGAGG - Intergenic
1066812416 10:39357170-39357192 TGCACTGTGGTCTGAGAGACAGG - Intergenic
1066813350 10:39370463-39370485 TGCACTGTGGTCTGAGAGACAGG + Intergenic
1067062992 10:43087620-43087642 TGCAGTGTGCTCCCGAAGAGGGG + Intronic
1070443896 10:76475694-76475716 TGCACTGTGGTCTGAGAGACAGG - Intronic
1071964656 10:90840221-90840243 AGCAGTGAGCTCTAACAGAGAGG - Intronic
1072564758 10:96608222-96608244 TGCACTGTTCTCACCCTGAGAGG + Intronic
1072839506 10:98755659-98755681 TGCACTGTGGTCTGAGAGGGTGG - Intronic
1073944831 10:108738610-108738632 TGCACTGTGGTCTCAGAGCATGG + Intergenic
1074520418 10:114216257-114216279 AGCAATGTGGTGTCACAGAGTGG - Intronic
1074759080 10:116652253-116652275 TGCACTGTGGTCTGAGAGTGTGG + Intergenic
1074921099 10:118013409-118013431 AACACTGTGCTTTCACAGACAGG + Intronic
1075389466 10:122082484-122082506 TGCAGGGGGCTCTCACAGAGAGG + Intronic
1075400822 10:122160295-122160317 TGGACTGTGGTCTAACAGACAGG + Intronic
1075582736 10:123634425-123634447 TGCACTGTGCTGTCTCAGAAGGG + Intergenic
1076079943 10:127570235-127570257 TACACTGTGTTCACACAGAAGGG - Intergenic
1078534762 11:12163916-12163938 TGCACTGTGTTCTCTCACAGAGG + Intronic
1078849928 11:15154591-15154613 TGCACTGTGCTCTCCTGCAGGGG - Intronic
1079403727 11:20127258-20127280 TGCTCTGTGTCCTCACACAGTGG - Intergenic
1079735907 11:23996829-23996851 TGCACTGTGGTCTGAAAGTGTGG - Intergenic
1080736905 11:35024767-35024789 TGCACTGTGGTCTGAGAGACAGG - Intergenic
1083762917 11:64828387-64828409 TGCACTGGGGTCCCACAGAATGG - Intronic
1084036400 11:66513953-66513975 TGCTCTGTGGACACACAGAGGGG - Intronic
1084536331 11:69759437-69759459 TTGACTGTCCTCTCACTGAGAGG - Intergenic
1086580831 11:88396454-88396476 TGCACTGTGGTCTGAGAGATAGG + Intergenic
1087166735 11:95012389-95012411 TGCACTGTGCCCACCAAGAGGGG - Intergenic
1088307430 11:108424801-108424823 TGCACTGTGGTCTGAGAGACTGG - Intronic
1088418288 11:109613948-109613970 TGCACTGTGGTCTGAGAGGGTGG - Intergenic
1089593884 11:119562893-119562915 TGCACTGTGGTCTGTGAGAGTGG - Intergenic
1089775958 11:120836053-120836075 TGCCCTGCACTCTGACAGAGTGG + Intronic
1090430534 11:126642422-126642444 TGTAATGTGCTTTCACAGAGAGG - Intronic
1091850180 12:3690505-3690527 TGTGCTGTGGTCTGACAGAGTGG + Intronic
1093490962 12:19703589-19703611 TGCACTGTGGTCTGAGAGTGTGG - Intronic
1093978693 12:25452229-25452251 TGCACACGGCTCTCACAGAGAGG + Intronic
1095444391 12:42269756-42269778 TTCACTGTGTTCTCACATAGTGG - Intronic
1096746153 12:53728181-53728203 TGGACTGGGCTCCCCCAGAGTGG + Intergenic
1097452588 12:59753901-59753923 TGCACTGTGTTCTGAGAGACAGG - Intronic
1097467787 12:59949433-59949455 TGCACTGTGGTCTGAGAGACAGG - Intergenic
1098176708 12:67799555-67799577 CTCTCTGTGCTCACACAGAGGGG + Intergenic
1099115484 12:78619231-78619253 TTCACTGTGTACTCACATAGTGG + Intergenic
1100913084 12:99387649-99387671 TTCTCTGTGTTCTCACACAGTGG - Intronic
1103184312 12:118943200-118943222 TGCTGTGTGCTCTCACACACAGG + Intergenic
1104180580 12:126376454-126376476 TGCACTGTGGTCTGAGAGTGCGG + Intergenic
1104936497 12:132367258-132367280 TGCGCTGTGCATTCACAGAATGG - Intergenic
1107409997 13:40149771-40149793 TGCACTGTGCTAGCAAAGAATGG - Intergenic
1109325871 13:60867381-60867403 TGCACTGTGGTCTGATAGAGTGG + Intergenic
1111045740 13:82811478-82811500 TGCTCTGTGTTCTCAGAAAGAGG + Intergenic
1111615424 13:90656273-90656295 TGCACAGTGCTGTCATATAGTGG + Intergenic
1111912389 13:94327251-94327273 TGCAGTTTGCTGACACAGAGGGG - Intronic
1112143175 13:96669266-96669288 TGCACTGTGTTGCCAGAGAGTGG + Intronic
1112841504 13:103584883-103584905 TTCACTGTGTGCTCACAGAGTGG + Intergenic
1112977089 13:105333730-105333752 CTCACTGTGTTCTCACAGAGTGG + Intergenic
1113019700 13:105870972-105870994 TGCAATGTGGTCTCACACTGTGG - Intergenic
1113539018 13:111092412-111092434 CTCACTGTGTCCTCACAGAGGGG - Intergenic
1115044944 14:28980382-28980404 TGCACTGTGATCTGAGAGAGTGG - Intergenic
1116717371 14:48444872-48444894 TGCACTGTGGTCTGAGAGACAGG - Intergenic
1116799520 14:49428859-49428881 TGTGCACTGCTCTCACAGAGAGG + Intergenic
1118389232 14:65282248-65282270 TGCACTGTAATCTCAGAGAGAGG - Intergenic
1118892743 14:69923521-69923543 TGCTCTGTTCTCTCTCAGTGCGG + Intronic
1119429275 14:74555412-74555434 CCCCCTCTGCTCTCACAGAGGGG - Intronic
1120634447 14:86934216-86934238 AGCACTCTGCTCTTACAGTGTGG - Intergenic
1121786129 14:96662426-96662448 TGCACTGTCCTCTCCCAAATGGG - Intergenic
1122798379 14:104217670-104217692 GGCACTGTGCTGGCACAGTGAGG + Intergenic
1124396238 15:29304437-29304459 TGCACTGTGGTCTGATAGTGTGG - Intronic
1124658483 15:31526823-31526845 TGGACTGAGCTCACACACAGGGG + Intronic
1125552486 15:40556457-40556479 AGCACAGTGCTATCACACAGTGG + Intronic
1126707558 15:51420566-51420588 TGCACTGTGGTCTGAGAGATAGG + Intergenic
1129246946 15:74285107-74285129 TGGTCAGTGCTGTCACAGAGCGG + Intronic
1129451480 15:75653569-75653591 TCCACTGTGCCCTCCCAGATGGG + Intronic
1132087786 15:98922272-98922294 TCCACTCTGCTCTCAAAGAAAGG - Exonic
1132119409 15:99163770-99163792 TTCACTGTGTCCTCACAGGGTGG - Intronic
1132299374 15:100766828-100766850 TGTACTGTGTTCTCTCAGACAGG + Intergenic
1133034814 16:3028717-3028739 TGCACAGTGCCCTCTCAGACCGG - Exonic
1133451618 16:5908895-5908917 TGCTGTGTCCTCACACAGAGAGG - Intergenic
1133707622 16:8370187-8370209 TTCACTGTGCCCTCACATGGTGG + Intergenic
1135401939 16:22172091-22172113 TGCACTGTTCTCCCACCCAGGGG + Intronic
1136450572 16:30352280-30352302 TGCATTGTACTGGCACAGAGAGG - Exonic
1137016461 16:35380555-35380577 TGCTCTGTGCTCTCCCACACAGG - Intergenic
1137025649 16:35471331-35471353 TGCACTGTGGTCTGAGAGACAGG - Intergenic
1138883636 16:61048387-61048409 TGCACTGTGGTCCAAAAGAGTGG + Intergenic
1139393342 16:66620317-66620339 TCCCCTCTGCTCCCACAGAGAGG - Intronic
1140880551 16:79194383-79194405 TAGACTGTGATCTCACTGAGAGG - Intronic
1142522506 17:515034-515056 TTCACTCTGCTCTTACTGAGGGG - Exonic
1142896369 17:2981592-2981614 TCCAGTCTGCTGTCACAGAGGGG + Intronic
1142896961 17:2986727-2986749 TGGACTGTGCACTCAGGGAGGGG - Intronic
1143337858 17:6186954-6186976 TGCTGTGTCCTCTCATAGAGGGG - Intergenic
1145236381 17:21211068-21211090 TGCACTGTGCTTTCCTAGATGGG + Intronic
1147987327 17:44314216-44314238 TGCACTGTGGGTTCACAGGGAGG + Intronic
1151371136 17:73646832-73646854 TACTCTGTTCGCTCACAGAGGGG + Intergenic
1151680251 17:75619312-75619334 TGCCCTCTGCTCACACAGAGGGG - Intergenic
1152643523 17:81458737-81458759 TGCACAGTGGGCTCCCAGAGTGG - Intronic
1154499401 18:14987663-14987685 TGCACTGTGCTTTCCTTGAGGGG + Intergenic
1157480213 18:48049156-48049178 GGCACTGTGGTCTAACAGAGGGG - Intronic
1157541086 18:48507786-48507808 TCCACTGTGGTCTGAGAGAGTGG - Intergenic
1159395431 18:67849317-67849339 TGCACTGTGGTCTGAGAGTGTGG - Intergenic
1163220206 19:15913536-15913558 TGCCCTGTGCTCAGCCAGAGAGG + Exonic
1166659441 19:44636637-44636659 AGCACTGAGCTCCCACAGACAGG - Exonic
1167618334 19:50548336-50548358 AGCACTGTGCTCTCAAAGCCCGG + Intronic
1167707860 19:51092290-51092312 TGCAGTGGGCACTCACAGATGGG - Intergenic
925043964 2:756807-756829 CTCACTGTGTTCTCACAGTGGGG - Intergenic
925652055 2:6101456-6101478 TCCACTGTGGTCTGAGAGAGTGG + Intergenic
926130046 2:10297317-10297339 TGCACTGTCCACTCACCGAGCGG - Intergenic
927092662 2:19723836-19723858 TGCACTGAGCCCTCACTGACAGG + Intergenic
927484151 2:23477500-23477522 TGCACTGTGGGGTCACAGGGTGG - Intronic
928490832 2:31781016-31781038 TGCACTGTGGTCTGAAAGAGTGG - Intergenic
929595861 2:43175367-43175389 AGCCCTGTGGTCTCACAGAATGG + Intergenic
930107177 2:47649478-47649500 TGCACTGTGTCCTCACATGGTGG - Intergenic
930157542 2:48120768-48120790 TACACAGTGCTCCCACAGAGAGG - Intergenic
930557678 2:52919816-52919838 TTTGCTGTGTTCTCACAGAGTGG - Intergenic
930928533 2:56851479-56851501 TGCATTGTTCTCTCACATATGGG + Intergenic
932112242 2:69012254-69012276 TGCACTGAGGGCTCCCAGAGCGG + Intergenic
932535142 2:72584805-72584827 TCCACTGTGCTCTGAGAGTGTGG - Intronic
932700699 2:73989346-73989368 AGCACAGCACTCTCACAGAGAGG - Intronic
932868448 2:75372230-75372252 TGCACTGTGGTCTGAGAGACAGG + Intergenic
932892622 2:75609999-75610021 TGCACTGTGTTCCCACAGGCTGG + Intergenic
934012423 2:87837365-87837387 TGCACTGTGGTCTGAGAGTGTGG - Intergenic
935481659 2:103596828-103596850 TGCACTGTGGTCTGACAGTGTGG - Intergenic
936349541 2:111702466-111702488 TCCTTTGTGCTCACACAGAGAGG - Intergenic
936636212 2:114261559-114261581 TGCTCTGTGCTCTCAGAGTGAGG + Intergenic
938989327 2:136611805-136611827 AGGCCTGTGCTGTCACAGAGAGG + Intergenic
939557671 2:143695919-143695941 TGCACTATGATCTCACATTGGGG - Intronic
939782161 2:146462671-146462693 TGCACTGTGGTCCCAGAGTGTGG + Intergenic
940672984 2:156693641-156693663 TTCTCTGTGCTCTCACATGGTGG - Intergenic
941550596 2:166910959-166910981 TGCACTGTGGTCTGAGAGACAGG + Intronic
942128455 2:172851284-172851306 TGCACTGTGGTCTAAGAGTGTGG + Intronic
942326724 2:174782289-174782311 TGCTCTGCGCCCCCACAGAGCGG + Intergenic
942761303 2:179400891-179400913 TGCACTGTGCAGTGCCAGAGAGG - Intergenic
943297562 2:186157642-186157664 TGCTCTGTGATCTTAGAGAGTGG - Intergenic
945820588 2:214659997-214660019 TGCACTGTGATCTGAGAGAGTGG + Intergenic
1170833543 20:19863912-19863934 TTCACTGTGCTCTCACAGCCTGG - Intergenic
1171081738 20:22193626-22193648 TGCACTGTGGTCCAAGAGAGTGG - Intergenic
1172244698 20:33437908-33437930 TCCACTGTTCCCTCACAGTGTGG - Intronic
1172409539 20:34711077-34711099 TGCACTGTGCTTGCTCAGAGAGG + Exonic
1172563255 20:35907684-35907706 TCCACTGTGGTCTCAGAGTGTGG + Intronic
1173568913 20:44064450-44064472 TGCACTGTGCTGGCTCAGAATGG + Intronic
1175211901 20:57363921-57363943 AGCACAGTGCTGTCACAAAGTGG + Intronic
1175665827 20:60859069-60859091 TGCACTGTGAGCTTTCAGAGAGG - Intergenic
1175719721 20:61278770-61278792 TCCACTGGGCTCCCACAGACTGG - Intronic
1176063339 20:63181775-63181797 TGCTCTGTGCTCTCACTGTCGGG - Intergenic
1176064777 20:63188772-63188794 TGCACCGTGCTCCCACAGTGGGG + Intergenic
1176350243 21:5787917-5787939 TGCAGTGTGGTCTGAGAGAGAGG - Intergenic
1176357057 21:5908501-5908523 TGCAGTGTGGTCTGAGAGAGAGG - Intergenic
1176544564 21:8185987-8186009 TGCAGTGTGGTCTGAGAGAGAGG - Intergenic
1176563515 21:8369032-8369054 TGCAGTGTGGTCTGAGAGAGAGG - Intergenic
1177348074 21:19899825-19899847 TGCGCGCTGCTCTCACAGGGAGG + Intergenic
1177393853 21:20508479-20508501 TGCATCAGGCTCTCACAGAGAGG - Intergenic
1177480529 21:21681138-21681160 TGCACTGTGGTCTGAGAGTGTGG + Intergenic
1177703610 21:24672066-24672088 TGGACTGTGCTGACACATAGAGG - Intergenic
1179954672 21:44731921-44731943 TTCACTGTGTCCTCACACAGTGG + Intergenic
1179984637 21:44913688-44913710 TGCCCTGTTCTCCCACAGAAGGG - Intronic
1180534231 22:16382153-16382175 TGCACAGAGCTTGCACAGAGGGG - Intergenic
1180913874 22:19471937-19471959 TGCACTGTGCTCTCACAGAGGGG - Intronic
1184040738 22:41941743-41941765 AGCACTCTGATCTCACAGATGGG - Intronic
1184131266 22:42518082-42518104 CGCCGTGTGCTCTCACATAGAGG + Exonic
1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG + Intergenic
1185008822 22:48301652-48301674 TGCAATCAGCTCTCAGAGAGAGG - Intergenic
1185138418 22:49086940-49086962 TGCACTGTCCTCACACTGGGAGG + Intergenic
1203249433 22_KI270733v1_random:102224-102246 TGCAGTGTGGTCTGAGAGAGAGG - Intergenic
1203315412 22_KI270737v1_random:3643-3665 TGCACAGAGCTTGCACAGAGGGG + Intergenic
949878428 3:8642245-8642267 TGCAGTGTCCTAGCACAGAGCGG - Intronic
950613153 3:14138995-14139017 TGCCCTGTGCTCTGCCAGATGGG + Intronic
952460902 3:33525348-33525370 TGTACATGGCTCTCACAGAGAGG + Intronic
952555813 3:34529295-34529317 TGCACTGGGTTATCACAGATAGG - Intergenic
953126689 3:40097279-40097301 TTGCCTGTGGTCTCACAGAGAGG + Intronic
953387840 3:42516674-42516696 TGCCCAGTGCTGTCAGAGAGGGG + Intronic
953964802 3:47295915-47295937 TGCTCTGTCCTATCACAGTGGGG + Intronic
954480335 3:50794078-50794100 TGTGCTGTGGTCTGACAGAGTGG + Intronic
954918936 3:54172927-54172949 TGCCCTCAGCTCTCTCAGAGAGG - Intronic
956528844 3:70194549-70194571 TTCACTGTGCTATAACAGAAAGG - Intergenic
957808642 3:85187191-85187213 TGCACTGTGCTGTCAAAGAGAGG - Intronic
957964995 3:87310746-87310768 TACACTGTGTACTCAGAGAGAGG - Intergenic
958615696 3:96491228-96491250 TGCACTGTGGTCTGACAGTGTGG + Intergenic
958985730 3:100777567-100777589 TTCTCTTTGCTCTAACAGAGGGG + Intronic
959291270 3:104477267-104477289 TGTACTGTGATCTGAGAGAGAGG - Intergenic
959998805 3:112708836-112708858 TGCACTGTGGTCTGAGAGAGTGG + Intergenic
960688346 3:120316344-120316366 TGCATTGTGGTCTGAGAGAGTGG - Intergenic
962327999 3:134451729-134451751 CACACTGGGCTTTCACAGAGTGG + Intergenic
966459713 3:180163187-180163209 TCCACTGTGGTCTGAGAGAGTGG + Intergenic
966532140 3:180992927-180992949 CTCACTGTGTTCTCACAGGGTGG - Intergenic
967282921 3:187839749-187839771 TGCAGTGTGCGCTCTCAGAAGGG + Intergenic
967881421 3:194304486-194304508 AGCACTGTGCTCACACAGCGGGG - Intergenic
968030648 3:195484297-195484319 ACCACTGTGCTGTCACACAGAGG - Intergenic
968030666 3:195484639-195484661 ACCACTGTGATATCACAGAGAGG - Intergenic
968030700 3:195485285-195485307 TCCACTGTGATATCACACAGAGG - Intergenic
968031476 3:195499603-195499625 ACCACTGTGCTGTCACACAGAGG - Intergenic
969542159 4:7799208-7799230 AGCAGTGTGATCTAACAGAGAGG - Intronic
970703713 4:18773709-18773731 GGCACTGTGATCTCAGAGTGTGG - Intergenic
970860521 4:20697792-20697814 TTCACTGTGTCCTCACATAGTGG + Intronic
974650312 4:64746841-64746863 TGCACTGTGGTCTGAGACAGTGG + Intergenic
975352652 4:73362903-73362925 TGCACTGTGGTCTGAGAGACAGG - Intergenic
977394296 4:96452133-96452155 TGCACTGTGATCTGAGAGTGTGG + Intergenic
977953975 4:103005741-103005763 TGCACTGTGGTCTAAGAGTGTGG - Intronic
978596487 4:110382576-110382598 TGCACTGTGGTCCAAGAGAGTGG - Intronic
979009772 4:115352983-115353005 TGCACTGTGGTCTTAGAGACTGG + Intergenic
979057510 4:116015464-116015486 TCCATTGTGCTGTCAGAGAGGGG - Intergenic
979831781 4:125314441-125314463 TGCACTGTGCATTCCCAGACAGG + Intergenic
980504175 4:133693338-133693360 TGCACTGTGTTCTGACAGTGTGG - Intergenic
980576484 4:134688550-134688572 TGCACTGGGCTATCACACACTGG - Intergenic
980580865 4:134748165-134748187 TGCACTGTGATCTGACAGTATGG - Intergenic
981008932 4:139904520-139904542 TGCTTTGTGCTCCCACAGCGTGG - Intronic
981038739 4:140199910-140199932 TTCACTGTGTTCTCACATGGTGG + Intergenic
981249486 4:142582714-142582736 TGCACTGTGCTTCCAGTGAGTGG - Intronic
981275706 4:142896784-142896806 TGCACTGTGGTCCAACAGTGTGG + Intergenic
982090266 4:151874521-151874543 AGCATTTTGCTCTCACACAGGGG - Intergenic
982924796 4:161321810-161321832 TTCGCTGTGTCCTCACAGAGTGG - Intergenic
984556079 4:181215497-181215519 TGTGCTTTGCTCTCAAAGAGTGG + Intergenic
985851287 5:2390752-2390774 AGCCCTGTGCTCAGACAGAGAGG + Intergenic
987294148 5:16535488-16535510 TGCACGCTGCCTTCACAGAGTGG + Intronic
988967056 5:36429827-36429849 TGCACTGTGGTCCAAGAGAGTGG + Intergenic
989214537 5:38891373-38891395 TGTGCGCTGCTCTCACAGAGAGG + Intronic
991211644 5:64111957-64111979 TGCACTGTGGTCTGAGAGTGTGG - Intergenic
993148379 5:84126793-84126815 TGCATTAAGCACTCACAGAGTGG + Intronic
993178202 5:84516036-84516058 TGCACTGTGTTCTGTTAGAGTGG + Intergenic
993578669 5:89633268-89633290 TGCACTGTGGTCTGAGAGACAGG + Intergenic
994907875 5:105864089-105864111 TGCACTGTGGTCTGAGAGTGTGG - Intergenic
995818057 5:116193963-116193985 TCCACTGTGGTCTGAGAGAGTGG - Intronic
997188370 5:131904458-131904480 TGCTCTGTGGTCTGAGAGAGTGG - Intronic
998776630 5:145610360-145610382 TGAGCACTGCTCTCACAGAGAGG - Intronic
1004224939 6:13776576-13776598 TGCTGTGTCCTCACACAGAGTGG - Intergenic
1005407839 6:25510184-25510206 TGGAATCTTCTCTCACAGAGTGG + Intronic
1006361016 6:33586994-33587016 TGCAGTGTGCACTCACTCAGGGG - Intergenic
1007237669 6:40402643-40402665 TTGACTAAGCTCTCACAGAGAGG + Intronic
1007314591 6:40976590-40976612 TGCTCTGTGATCTGAGAGAGTGG + Intergenic
1008021081 6:46578073-46578095 TGCACTGTGGTCTGAGAGTGTGG - Intronic
1008397148 6:51022260-51022282 TTCACTGTGTCCTCACATAGTGG + Intergenic
1008621630 6:53276949-53276971 GGCACTATGCTGTCACAGAGAGG + Intronic
1009446535 6:63749329-63749351 TGCACTGTGATCTGACAGAGTGG + Intronic
1010098572 6:72076380-72076402 CTCACTGTGCTCTCACATGGTGG + Intronic
1011563088 6:88643647-88643669 TGCACTGTGGTCTGAGAGACAGG - Intronic
1013080961 6:106812236-106812258 TGCTCTGTGGTCTGACAGAGTGG - Intergenic
1013535379 6:111058846-111058868 TCTACTGTGCTCTCACAGCTTGG + Intergenic
1013940818 6:115659609-115659631 TCCACTGTGGTCTGAGAGAGTGG + Intergenic
1014127096 6:117789314-117789336 TTCACTGTGATCTCACATGGTGG + Intergenic
1014280015 6:119431730-119431752 TGACCTGTGCAGTCACAGAGGGG + Intergenic
1015423883 6:133041853-133041875 TACACTGAGCTCTCAAAGATGGG - Intergenic
1016129590 6:140449990-140450012 TTCACTGTGTTCTCACATGGTGG - Intergenic
1017371467 6:153714221-153714243 TGCACTGTGCCCTCACATGGGGG + Intergenic
1017590523 6:155974195-155974217 TGCTCTGTCATCTCAGAGAGGGG - Intergenic
1017601548 6:156088267-156088289 TGCACTGTGGTCTGAGAGTGTGG - Intergenic
1018589405 6:165401721-165401743 AGCAGTCTCCTCTCACAGAGTGG - Intronic
1019650485 7:2155023-2155045 TGGACTGTGAGCTCTCAGAGAGG + Intronic
1019900977 7:4020441-4020463 AGCAATGTACTGTCACAGAGGGG - Intronic
1020282864 7:6659161-6659183 TGCCCTGTCCCCTCTCAGAGAGG + Intergenic
1020382207 7:7558795-7558817 TGCACTGTGGTCCAAGAGAGTGG - Intergenic
1020549881 7:9590294-9590316 TGCACTGTGGTCTGAGAGAGTGG - Intergenic
1023679938 7:42675135-42675157 TTCACTGTGTCCTCACATAGTGG + Intergenic
1023785429 7:43703182-43703204 TGCACTGTGGTCTGACAGTGTGG + Intronic
1028638486 7:93017096-93017118 TGCACCGTGCTCTCAAGGACAGG + Intergenic
1028822325 7:95226797-95226819 GGCAATGTGCTCTCAGAGAAGGG + Intronic
1029366013 7:100116902-100116924 TGCACTCTGCCCTCAGAGTGGGG + Intronic
1030636151 7:111951484-111951506 TGCCCTGTTCTTTCAAAGAGAGG - Intronic
1032084314 7:128875966-128875988 TGCTCTGTTCTCTCACGGAATGG - Intronic
1032249681 7:130244455-130244477 TGCACTGTGGTCTGAGAGAGTGG + Intergenic
1033620878 7:143061240-143061262 TGCAGTGTGGTGTCACAGTGTGG - Intergenic
1034285312 7:149880029-149880051 TGCACTGTGCTCGGACTGACAGG - Exonic
1034472015 7:151260095-151260117 TTCACTGTGCTATCACAGGGTGG + Intronic
1038711161 8:29947161-29947183 TGCCATGTGCTTTCCCAGAGTGG + Intergenic
1039838500 8:41277065-41277087 AGCACTTTGCTCTCAGAGTGGGG - Intronic
1040977640 8:53212167-53212189 TGCACTGTGGTCCAAGAGAGTGG + Intergenic
1043646941 8:82533408-82533430 TGCACTGTGGTCTGAGAGACTGG + Intergenic
1043675961 8:82953849-82953871 TGCACTGTGGTCCACCAGAGAGG - Intergenic
1044159876 8:88899710-88899732 TGCACTGTGGTCTGAGAGATAGG - Intergenic
1044312239 8:90707503-90707525 TGCACTGTGGTCTGAGAGAGTGG + Intronic
1044793768 8:95874927-95874949 TGCACTATGGTCTGAAAGAGTGG - Intergenic
1045908977 8:107383125-107383147 TGCACTGTGGTCAGACAGAAAGG - Intronic
1045933260 8:107651558-107651580 TGCACTGTGGTCTGAGAGACAGG + Intergenic
1046487601 8:114908325-114908347 TGCATTCCACTCTCACAGAGAGG + Intergenic
1047296676 8:123576466-123576488 TGTGATGTGCTCTCACAGGGAGG + Intergenic
1048685223 8:136897457-136897479 TTCACTGTGCCCTCACATGGTGG - Intergenic
1049636058 8:143690070-143690092 GGCACTGTGCTTCCCCAGAGGGG + Exonic
1049690674 8:143957604-143957626 TGCTCTGTGCCCAGACAGAGGGG - Intronic
1051039969 9:12796724-12796746 TTTACTGAGCTCTCACATAGAGG + Intronic
1051588979 9:18756806-18756828 AACACTGTGTTCACACAGAGAGG - Intronic
1052694344 9:31856532-31856554 TTCACTGTGGTCTGACAGTGTGG - Intergenic
1052746403 9:32445956-32445978 TGCACTGTGGTCTGAGAGACAGG + Intronic
1053152902 9:35754270-35754292 TGCCCTCTGCTCTCACAGGCTGG + Exonic
1053531078 9:38881814-38881836 TGCACTGTGGTCTGAGAGACTGG - Intergenic
1054203301 9:62106246-62106268 TGCACTGTGGTCTGAGAGACTGG - Intergenic
1054635061 9:67482118-67482140 TGCACTGTGGTCTGAGAGACTGG + Intergenic
1054839731 9:69723767-69723789 AGCACAGTGCTCTCACTTAGTGG + Intronic
1055255341 9:74363140-74363162 AGCAATTTGCTCTCATAGAGAGG - Intergenic
1055422005 9:76153467-76153489 TACACAGTGCTTGCACAGAGTGG + Intronic
1056120367 9:83481829-83481851 TGCACTGTGATCACCAAGAGGGG + Intronic
1057057791 9:91977319-91977341 AGCACTGTGTTCTCACTTAGTGG - Intergenic
1057291149 9:93808290-93808312 TGCCCTGTGTCCTCACAGTGAGG - Intergenic
1057638320 9:96792962-96792984 TGCACTGTGGTCTGAGAGAGTGG + Intergenic
1057980190 9:99652912-99652934 TGCACTCTGGTCTGAGAGAGTGG - Intergenic
1058596525 9:106621455-106621477 TGCATTGTGCACTCACATAAAGG - Intergenic
1061629345 9:131862070-131862092 TGCTCAGAGCTCCCACAGAGTGG - Intronic
1062048882 9:134437197-134437219 TGCCCTGTGCTCTGAGTGAGGGG + Intronic
1062356981 9:136169719-136169741 TGGACTTTGACCTCACAGAGGGG + Intergenic
1203465827 Un_GL000220v1:85485-85507 TGCAGTGTGGTCTGAGAGAGAGG - Intergenic
1185493575 X:537539-537561 TGCACTGTCCTCCCAGAGACGGG + Intergenic
1187607568 X:20903110-20903132 TGCACTGTGATCTGAGAGTGTGG + Intergenic
1188044913 X:25414503-25414525 TGAACTGTGCTCCCAAAAAGGGG + Intergenic
1188806710 X:34599778-34599800 TGCACTGTTGTCCCAGAGAGTGG + Intergenic
1189557432 X:42160126-42160148 TGCGCTGTGATCTGAGAGAGTGG + Intergenic
1189653364 X:43213870-43213892 TGCACTGTGGTCTGAGAGTGTGG - Intergenic
1189926733 X:45962500-45962522 TGCACTGTGGTCTGAGAGTGTGG - Intergenic
1190905117 X:54719726-54719748 TGCACTGTGGTCTGAGAGACAGG + Intergenic
1191063986 X:56328335-56328357 TGCACTGTGGTCTGAGAGACAGG + Intergenic
1191217195 X:57945640-57945662 TGCACTGTGATCTGACAGTGTGG + Intergenic
1192756618 X:74052641-74052663 TGCACTGTGGTCTAACAGTATGG - Intergenic
1192923391 X:75731586-75731608 TGCACTGTGATCAGAGAGAGTGG + Intergenic
1193578091 X:83228820-83228842 TTCACTGTGGTCTGACAGTGTGG + Intergenic
1194048731 X:89040464-89040486 TGCACTGTGGTCCAAGAGAGTGG + Intergenic
1194525746 X:94975633-94975655 TGCACTGTGTTCTAACAGAGAGG + Intergenic
1194982493 X:100454644-100454666 TGCACTGTGGTCTGAGAGTGTGG - Intergenic
1195144841 X:102002873-102002895 TGCACTGTGATCTGAAAGCGTGG - Intergenic
1195270397 X:103223106-103223128 TGTACTGTGGTCTGAGAGAGTGG - Intergenic
1196589580 X:117470558-117470580 TGCAGTCTGCTCTCACAGCAGGG + Intergenic
1197914180 X:131516870-131516892 TTCACTGTGTCCTCACATAGTGG - Intergenic
1197920823 X:131591899-131591921 TGGCATGTGCTCTAACAGAGGGG + Intergenic
1198891266 X:141399714-141399736 TGCACTGTGGTCTGAGAGAGTGG + Intergenic
1199132052 X:144201122-144201144 TGCACTGTGGTCTGAGAGTGTGG + Intergenic
1199269819 X:145870322-145870344 TGCATTGTGGTCTCAGAGAGTGG + Intergenic
1201079127 Y:10218035-10218057 TGCACATTGGTCTCACAGGGTGG - Intergenic
1201538332 Y:15076993-15077015 TTCACTGTGCTCACACACTGAGG + Intergenic
1201962596 Y:19698687-19698709 GTCACTGTGTTCTCACACAGTGG + Intergenic