ID: 1180915762

View in Genome Browser
Species Human (GRCh38)
Location 22:19485434-19485456
Sequence GATGGAGCCAAGAGGATTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 1, 2: 3, 3: 22, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180915762 Original CRISPR GATGGAGCCAAGAGGATTCC TGG Intronic
900078039 1:833932-833954 GCTGGAGGCAAGATGATGCCTGG + Intergenic
900298130 1:1962786-1962808 GATTGAGGCAGGAGGATTGCTGG + Intronic
903326123 1:22569596-22569618 GATGCAGCCATGGGGATCCCCGG - Intronic
903967058 1:27097432-27097454 GTTAGTGCCAAGAGGATTACAGG - Intergenic
905343927 1:37298645-37298667 GATGGAACAAAGAGGACTCTGGG + Intergenic
906653646 1:47532723-47532745 GGTGGAGCACAGAGGATTTCAGG + Intergenic
906690352 1:47788578-47788600 TATGGAGCTAAGAGCCTTCCAGG - Intronic
907570348 1:55477483-55477505 GATGGAGAGAAGAGAGTTCCAGG - Intergenic
908466613 1:64402390-64402412 CATGGGGCAAAGAGGTTTCCTGG - Intergenic
909911390 1:81262011-81262033 GATGGAGCACAGAGGATTTTAGG + Intergenic
910358904 1:86395560-86395582 GCTGGAACCTAGAGGAATCCTGG + Intronic
912369756 1:109164794-109164816 GATGGAGGGAAGAGGAAGCCAGG + Intronic
913038512 1:114999654-114999676 GATGGAACCAAAAAGATTTCTGG + Intergenic
913427846 1:118754506-118754528 AATGGCAACAAGAGGATTCCTGG - Intergenic
914405792 1:147370997-147371019 GATGTAGTCAAGAGGATGGCAGG - Intergenic
917212992 1:172648911-172648933 AGTGGGGCAAAGAGGATTCCAGG + Intergenic
918557591 1:185822069-185822091 GGTGGAGCACAGAGGATTCTTGG + Intronic
919693080 1:200544800-200544822 GATGGAGCCACGGGGATTCCTGG + Intergenic
920730853 1:208482813-208482835 GATGGGGACAAAAGCATTCCTGG + Intergenic
924878922 1:248136899-248136921 GATGGAGCCACGCGGATCGCGGG - Intergenic
1062999797 10:1905884-1905906 TTTGGTGCCATGAGGATTCCAGG + Intergenic
1067293845 10:44963122-44963144 GATGGAGACCAGGGGAGTCCAGG - Intronic
1067572460 10:47381460-47381482 GCCAGAGCCAGGAGGATTCCTGG - Intronic
1068520000 10:58067368-58067390 GATGGCAGGAAGAGGATTCCCGG - Intergenic
1070487384 10:76943674-76943696 CATGCAGGGAAGAGGATTCCAGG + Intronic
1070785798 10:79161498-79161520 GATGCAGCAAACAGCATTCCAGG - Intronic
1072636875 10:97184119-97184141 GATGCAGCCAAGAAGAGTCTGGG + Intronic
1074468064 10:113701655-113701677 AATGGAGCCAATAGGTTTGCAGG - Intronic
1074798782 10:116977773-116977795 GGTTGAGGCAGGAGGATTCCTGG - Intronic
1075190463 10:120302547-120302569 GATGGAGCCCAGAGGCTGGCAGG + Intergenic
1075610509 10:123851243-123851265 GAGGGAGAGAAGAGCATTCCAGG - Intronic
1075647806 10:124107973-124107995 GGTGGAGCCAGGGGGCTTCCAGG - Intergenic
1075674031 10:124283448-124283470 GATGGAGCAAGGAGGGGTCCAGG - Intergenic
1076542599 10:131223732-131223754 GATGGACCCCAGAGGCTTCTGGG - Intronic
1079710048 11:23671224-23671246 GATTAAGCTAAGAGAATTCCAGG + Intergenic
1081651867 11:44829310-44829332 GATGGAGCACAGAGGATTTGGGG - Intronic
1084475743 11:69387717-69387739 GGTGAAGCAAAGCGGATTCCAGG - Intergenic
1084731856 11:71078970-71078992 GGTGGAGCCAAGAGCCCTCCTGG + Intronic
1086418538 11:86614453-86614475 GATGGAGCAAAGAGGGGTTCTGG - Intronic
1087740586 11:101882678-101882700 GCTGAAGCCAAGAGGTTTCCAGG + Intergenic
1088747176 11:112813919-112813941 GATGGAGCCAAGAGAAGTCTAGG + Intergenic
1089840271 11:121411184-121411206 GATGGTGGCAAGAGAAGTCCTGG + Intergenic
1090439870 11:126716574-126716596 GATGGAGCACAGAAGATTCCTGG + Intronic
1091650003 12:2302854-2302876 GATGGAGCCGAGAGGCTCCCTGG - Intronic
1091664836 12:2411658-2411680 CAGGGAGCCCAGAGGTTTCCAGG + Intronic
1092971953 12:13704598-13704620 GATGGTGCCAATAGGATTTGGGG - Intronic
1093861413 12:24171760-24171782 GATTGAGGCAGGAGGATTGCTGG + Intergenic
1094142358 12:27194209-27194231 TATGGAGCTAAGAGGTTTCATGG + Intergenic
1094805973 12:34092681-34092703 GATGGAGCCAGGATGAGACCAGG + Intergenic
1095124661 12:38462661-38462683 GATGGAGCCAGGATGAGACCAGG + Intergenic
1097181118 12:57172555-57172577 GAGTGAGCCCAGAGGATCCCTGG - Intronic
1097203459 12:57299783-57299805 GATGCAGACAAGAAGATCCCAGG - Intronic
1098490300 12:71068120-71068142 GACTGAGTCAAGAGGATTGCTGG - Intronic
1100661020 12:96698951-96698973 TTTGGACCCAAGAAGATTCCAGG - Intronic
1102236788 12:111298724-111298746 GAGGGAGCCAGGAGGAGTCTGGG + Intronic
1102433936 12:112905607-112905629 GACGAAGCCAAGAGCCTTCCCGG - Intergenic
1102813585 12:115844333-115844355 GAGTGAGCCATGAGGATACCTGG - Intergenic
1104757432 12:131277899-131277921 GCTGGAGCCCAGAGGACTCCAGG + Intergenic
1106110232 13:26770805-26770827 GGTGGAGCACAGAGGATTTCAGG + Intergenic
1106579032 13:31001802-31001824 GCTGAAGCCAAGTGGATTGCTGG + Intergenic
1111695902 13:91623415-91623437 GATGAGGGCAAGAGGATTCCTGG + Intronic
1112903438 13:104388147-104388169 GATGGAGACATGAAGAATCCAGG - Intergenic
1113712221 13:112474464-112474486 GAAAGAGCCAAGAGGCTTTCAGG + Intergenic
1114066376 14:19062492-19062514 GAAGGAGCCGGGAGGGTTCCCGG - Intergenic
1114095892 14:19337532-19337554 GAAGGAGCCGGGAGGGTTCCCGG + Intergenic
1115200470 14:30848796-30848818 GATGGAGGCAAGAGGATCGCTGG - Intergenic
1116067022 14:39997412-39997434 GAGTTAGCCAAGAGGATACCTGG + Intergenic
1118056249 14:62082461-62082483 GATAGAGCCAATAGGATTTCAGG - Intronic
1118158671 14:63267027-63267049 CATGGAGACAAGTGGTTTCCTGG - Intronic
1119445827 14:74662589-74662611 GATGGAGCAAAGGGGAGTACAGG + Exonic
1125495782 15:40192521-40192543 AATGGAGCAAAGGGGATTTCTGG - Intronic
1125614348 15:40996622-40996644 GGTGAAGAAAAGAGGATTCCTGG - Intronic
1125735740 15:41924322-41924344 GATGGAGCCAGGAAGGTCCCAGG - Intronic
1127323406 15:57869005-57869027 GGAGGAGCCAAGAGGAACCCAGG + Intergenic
1128510932 15:68313634-68313656 GATGGAGCCAAGAGTGTCCCTGG - Intronic
1131177467 15:90219182-90219204 GATGGAGCCACCAGGATTTCTGG + Intronic
1131340595 15:91597116-91597138 GATGGAGACAAGAGCTTGCCTGG + Intergenic
1131955456 15:97730503-97730525 GATAGAGCCAAGTGGACTTCTGG - Intergenic
1132664045 16:1073565-1073587 GAAGACGCCAGGAGGATTCCAGG - Intergenic
1132685026 16:1158646-1158668 GATGGAGCCCAGAGCAGGCCGGG + Intronic
1133477519 16:6137843-6137865 GATTGAGGCAGGAGGATTACTGG - Intronic
1134103336 16:11468422-11468444 GACTGAGGCAAGAGGATTGCTGG - Intronic
1134806689 16:17131960-17131982 GGTGGATACCAGAGGATTCCTGG + Intronic
1139611118 16:68059473-68059495 GATGGAGCCAGGGGGAGTGCTGG + Intronic
1142810752 17:2394563-2394585 GAGGGAGACAGGAGGACTCCTGG + Intronic
1143258779 17:5583505-5583527 GCTGGAGCCAGGAGGCTTGCTGG - Intronic
1143371655 17:6444324-6444346 GAGGGAGCCAATCGGATCCCCGG + Intergenic
1144664194 17:17091034-17091056 GATGAAGCCAAGAGGACTCCTGG - Intronic
1145797632 17:27665034-27665056 CAGGAAGCCAAGATGATTCCAGG + Intergenic
1145812022 17:27769981-27770003 CAGGAAGCCAAGATGATTCCAGG + Intronic
1147167506 17:38601358-38601380 GATGGAGCTGAGAGGCTTCTTGG + Intronic
1147310731 17:39594888-39594910 GAGGCAGCCAAGAGGTTTTCTGG + Intergenic
1147702347 17:42404061-42404083 GCTGGAGCCAAGAGAAGCCCTGG - Exonic
1148323503 17:46771097-46771119 GCGGGAGCCAAGAGGGGTCCCGG - Intronic
1148962489 17:51405173-51405195 TTTGGGGCCATGAGGATTCCAGG + Intergenic
1149836386 17:59916699-59916721 GAAGGAGCCAAGAGGATTCCAGG - Intronic
1151366287 17:73618427-73618449 TATGGAGCCACAAGGATTCAAGG + Intronic
1151699514 17:75735881-75735903 GATGGAGGGAAGGAGATTCCAGG + Intronic
1151701218 17:75743597-75743619 GAGGGAACCAAGCGGACTCCTGG + Intronic
1155282612 18:24255564-24255586 GAAGGAGGGAAGAGGCTTCCAGG - Intronic
1156446773 18:37242525-37242547 GATGGAGAAAACAGGATTCTGGG - Intergenic
1156546911 18:37972734-37972756 GATGGCCAGAAGAGGATTCCTGG - Intergenic
1157832338 18:50867921-50867943 GATGGAGCCAGGACTACTCCTGG + Intergenic
1158580455 18:58676439-58676461 GATGGAGACAAGAAGATATCAGG - Intronic
1160125707 18:76169586-76169608 GATGCAGCCAAGGGGATTCCAGG + Intergenic
1161385655 19:3991189-3991211 GATAGAGGCAGGAGGGTTCCTGG - Intergenic
1162947083 19:14050644-14050666 GAGGGAGCCATGTGGATACCTGG + Intronic
1163390644 19:17027734-17027756 CAGGGAGCCCCGAGGATTCCGGG - Intergenic
1163881522 19:19927158-19927180 GGTCAAGCCAAGAGGATCCCTGG + Intronic
1164646702 19:29863650-29863672 GGTGGAGCCAAGAGGAGACCAGG - Intergenic
1166406841 19:42527628-42527650 GAGGGAGCCATGCGGATCCCTGG - Intronic
1166991024 19:46692815-46692837 GATGAAGGAAAGAGTATTCCTGG - Intronic
927087846 2:19689009-19689031 GAGGGAGCCAACAGGCTCCCTGG + Intergenic
927693492 2:25224418-25224440 GAGGGAGACAAGAGGCTGCCTGG - Intergenic
928067572 2:28181935-28181957 GAGTGAGCCATGAGGATTTCTGG + Intronic
929600675 2:43202527-43202549 GATGGAGCACAGAGGATTTTAGG - Intergenic
931170524 2:59798752-59798774 GATGGCGCCAAAAGGTTTCAGGG + Intergenic
931805305 2:65798099-65798121 GGAGGAGGGAAGAGGATTCCAGG + Intergenic
936450319 2:112628907-112628929 GATGGAGGCAGGAGGATAGCTGG - Intergenic
937215409 2:120309715-120309737 GACAGAGCCAGGAGGATTGCTGG - Intergenic
937237434 2:120439097-120439119 GATGGAGCAAGGAGAATTTCTGG - Intergenic
938128439 2:128690938-128690960 GATGGAGCCCAGACCATTCAGGG + Intergenic
940190542 2:151036228-151036250 GAGGGAGAGAAGAGGATGCCTGG - Intronic
944437828 2:199709762-199709784 GAGGGAGCAAAGAAGATACCTGG + Intergenic
944811001 2:203328000-203328022 GACGGAGCCGAGATGAGTCCCGG + Intergenic
946375477 2:219306293-219306315 GATGGGGCCAAGGTGATTGCAGG - Intronic
1169510607 20:6260065-6260087 GATGGAGGGAAGAGCATTCTAGG + Intergenic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1172962404 20:38807771-38807793 GCTGGAGCCAGGAAGGTTCCAGG - Intronic
1173922327 20:46755619-46755641 GAAGGAGCCATGTGGATACCTGG - Intergenic
1176305602 21:5121494-5121516 CTGGGAGCCAAGAGAATTCCAGG + Intronic
1178598672 21:33977224-33977246 CATGGAGTCAGGAGGACTCCTGG - Intergenic
1179792298 21:43762641-43762663 GAAGGAGCCAGGTGGATCCCAGG - Intergenic
1179851454 21:44140537-44140559 CTGGGAGCCAAGAGAATTCCAGG - Intronic
1180484854 22:15785083-15785105 GAAGGAGCCGGGAGGGTTCCCGG - Intergenic
1180915762 22:19485434-19485456 GATGGAGCCAAGAGGATTCCTGG + Intronic
1180990517 22:19933012-19933034 GCTGGAGCCTAGAGGAGCCCTGG + Intronic
1181904128 22:26179687-26179709 TATTGAGCCAAGAACATTCCAGG + Intronic
1182141159 22:27959615-27959637 TTTGGAGTCCAGAGGATTCCCGG - Intergenic
1184087667 22:42274861-42274883 GATACAGCCCAGAGGAATCCAGG + Intronic
1184176760 22:42793411-42793433 GAGGGAGCCTGGGGGATTCCAGG - Intergenic
949546837 3:5080042-5080064 GATGGAGGCTGGAGGAGTCCAGG - Intergenic
949943161 3:9170412-9170434 GGTGGGGGCAAGAGGGTTCCAGG + Intronic
950378219 3:12589662-12589684 GACTGAGCCAAGAGGATAGCTGG + Intronic
950456981 3:13098571-13098593 GAGGGAGCCAAGGAGATACCTGG + Intergenic
950685051 3:14610928-14610950 AATGAAGCCAAGAAGTTTCCTGG - Intergenic
952953333 3:38541902-38541924 GGTAGAGCCAACAGGATTTCCGG + Intronic
955469761 3:59274115-59274137 GATAGAGCCAACAGGATTTGCGG + Intergenic
955951098 3:64242805-64242827 GATGGGGCCAAGAGTGTACCTGG + Intronic
957559871 3:81809908-81809930 GATGGAGCCAAGAGGAGTGAAGG - Intergenic
959671864 3:108987553-108987575 GTTGGAGCCAGGAGGGTTACTGG + Intronic
960601009 3:119458362-119458384 GAGGGAGAAAAGAGGATCCCAGG - Intronic
965427987 3:168550856-168550878 AATGGAGCAAAGAGGTTTCTGGG + Intergenic
966416581 3:179695407-179695429 GCTGGTGCCAAAAGGCTTCCTGG + Intronic
976922306 4:90455471-90455493 GATGCAGTCAAGAGGAGTGCAGG + Intronic
980822085 4:138030610-138030632 GAGTGAGCAAAGAGCATTCCTGG - Intergenic
980906354 4:138951969-138951991 GATGGAGCCAGGAGGCATCCTGG - Intergenic
981890245 4:149727807-149727829 GATGAGCCCAAGAGGATTTCAGG + Intergenic
986857985 5:11893680-11893702 GATAGAGCCAAGATGATGGCTGG - Intronic
990825706 5:59894852-59894874 AAAGAAGCCAAGAGGATTTCAGG + Intronic
990859071 5:60305222-60305244 GATGAAATGAAGAGGATTCCAGG + Intronic
991151269 5:63373496-63373518 GATAGAGAAAAGATGATTCCTGG + Intergenic
991799066 5:70339298-70339320 GCTTGAGGCAAGAGGATTGCTGG - Intergenic
991947611 5:71914957-71914979 AATGAAGCCAATAGTATTCCAGG + Intergenic
992218478 5:74548281-74548303 GGTGGAGCCCAGTGGATACCAGG + Intergenic
996616955 5:125453460-125453482 GCTGGAACAAAGAGGAATCCAGG + Intergenic
996738205 5:126776750-126776772 GAAGGAGCCCGGAGGTTTCCGGG - Intronic
997406209 5:133648997-133649019 GGTGGAGCAAAGAGGATTTTTGG - Intergenic
997953437 5:138259967-138259989 TAGGGAGGCAAGAGGATTCAGGG + Intronic
998011566 5:138699590-138699612 GAGTGAGCCAAGAGGATGTCAGG + Intronic
998391327 5:141788797-141788819 GCTGGAGCCACAAGGATTCCAGG - Intergenic
998612363 5:143703278-143703300 GTTGGGGCCAAGAGGATCACAGG + Intergenic
998769129 5:145521745-145521767 CTTTGAGCCAAGAGGATACCTGG - Intronic
999634337 5:153604561-153604583 GATGGGCACAAGAGCATTCCTGG - Intronic
1003321445 6:5055593-5055615 AACTGAGCCAAGAGGATTCCAGG - Intergenic
1003702631 6:8486279-8486301 GATGGTGCCAAGATCATTCAAGG + Intergenic
1004001348 6:11599979-11600001 AATGGAGGAAAGAGCATTCCAGG + Intergenic
1004231716 6:13839820-13839842 GATGGTACCTAGAGGTTTCCAGG - Intergenic
1006105379 6:31713270-31713292 GATGGAGGCAAGAGGGGTACAGG + Intronic
1006565093 6:34949318-34949340 GATGGAGCCAGAAGGGTACCTGG + Intronic
1006993678 6:38238042-38238064 GATGGAAGCAGGAGGATTGCCGG + Intronic
1007097764 6:39224647-39224669 GTGGGATCCAAGAGGCTTCCGGG + Intronic
1007100062 6:39239879-39239901 GAAGGAGCAACCAGGATTCCTGG + Intergenic
1008315172 6:50030638-50030660 GGGGGATCCAAAAGGATTCCAGG - Intergenic
1008470849 6:51882654-51882676 GATGGGGCAAAGAGTACTCCCGG - Intronic
1009857586 6:69284324-69284346 GATGGATTCAAGAGGAAGCCTGG - Intronic
1013630793 6:111984161-111984183 CCTGGAGACAAGAGTATTCCTGG + Intergenic
1013687277 6:112600342-112600364 GGGGAAGCCAAGAGGCTTCCTGG - Intergenic
1013696718 6:112710933-112710955 CATGGAGCTAAGAGGAATCTAGG + Intergenic
1015087651 6:129314713-129314735 GCTGCAGCCAAGTGGATTCTTGG - Exonic
1015429162 6:133110126-133110148 GGTGCAGCCAAGGGGATGCCAGG + Intergenic
1017901284 6:158720482-158720504 GATGGAGCCAGGAGCAGACCTGG + Intronic
1018188271 6:161286849-161286871 ACCGGAGCCAAGAGCATTCCGGG + Intergenic
1018897883 6:168033822-168033844 GTGGGTGCCAAGAAGATTCCAGG - Intronic
1019436868 7:1026849-1026871 GATGAAGCCCAGAGGCTGCCTGG - Intronic
1023344882 7:39261294-39261316 GATGGAGGAAGGAGGATTCAGGG - Intronic
1026312678 7:69201060-69201082 GCTGACCCCAAGAGGATTCCTGG - Intergenic
1026874681 7:73872350-73872372 GAGGGAGAAGAGAGGATTCCTGG - Intergenic
1029633036 7:101765138-101765160 GAGGGAGCAAAAGGGATTCCAGG - Intergenic
1030846255 7:114416148-114416170 GATGGGCCCAATAGGATCCCAGG - Intronic
1032314572 7:130823360-130823382 GATGGTGTCAAGAGCATTTCTGG - Intergenic
1032429153 7:131846916-131846938 GATGGAGGGAAGCGCATTCCAGG + Intergenic
1032765304 7:134986392-134986414 GAGGGATCCCAGAGGATGCCGGG - Intergenic
1033395285 7:140967982-140968004 GAGGGAGCCAGGAGGAGACCTGG - Intergenic
1034660656 7:152766188-152766210 GGTGGAGCCTAGAGGAAACCGGG + Intronic
1035527582 8:325745-325767 GCTGGAGGCAAGATGATGCCTGG - Intergenic
1035545155 8:475211-475233 GATGGTGCCAAGACCATTCAAGG - Intergenic
1035642590 8:1195091-1195113 GCTGCAGCCATGAGGATGCCGGG - Intergenic
1036011991 8:4736363-4736385 GGAGGTGCCAAGAAGATTCCAGG + Intronic
1036224804 8:6948952-6948974 GATGGACCCAATAGGATTCAGGG - Intergenic
1039830297 8:41208083-41208105 GAAGGAGACAGGAGGATTCCTGG - Intergenic
1041301029 8:56411565-56411587 GATGGAGCCAAGAGGGCTCTGGG - Intergenic
1043216137 8:77591455-77591477 GAAGGAGCAAAGATGATTGCAGG + Intergenic
1044598319 8:93979785-93979807 GCTGGAGCCAAGTGGATGCATGG - Intergenic
1045027456 8:98101360-98101382 GATGGAGCCACGAGGTTTCTGGG + Intergenic
1046012939 8:108572546-108572568 GCTGGAGCCTAGAGGAGACCTGG + Intergenic
1046490332 8:114943819-114943841 TATGGAGCACAGAGGATTTCAGG - Intergenic
1047304877 8:123644607-123644629 GAGAGAACCCAGAGGATTCCTGG - Intergenic
1049541047 8:143209148-143209170 AATGGAGCATAGAGGGTTCCAGG + Intergenic
1050078050 9:1885012-1885034 GCTGGGACCAAGAGGCTTCCAGG + Intergenic
1050163737 9:2743503-2743525 GAGAGAGCCAAGAGGAGACCTGG + Intronic
1056850115 9:90076606-90076628 GATGGAGCCAAGAGAAGAGCTGG - Intergenic
1057310816 9:93941949-93941971 CATGGAGCAAAGAGGCTTGCTGG + Intergenic
1059623667 9:116036776-116036798 GATGGAGGGAAGAGGAATCTTGG + Intergenic
1203744851 Un_GL000218v1:36001-36023 CCAGGAGCCAAGAGGCTTCCTGG + Intergenic
1203565253 Un_KI270744v1:83483-83505 CCAGGAGCCAAGAGGCTTCCTGG - Intergenic
1186292751 X:8118470-8118492 GTGGGTGACAAGAGGATTCCTGG + Intergenic
1187358217 X:18598947-18598969 GGTGAAGGCAAGGGGATTCCTGG + Intronic
1189144314 X:38640080-38640102 AATGGAGCAAGGAGGATGCCAGG + Intronic
1193109368 X:77712162-77712184 GATGGAGCTAAGAGGATCCTTGG + Intronic
1195034657 X:100961481-100961503 GATGGAACCAAGATGAGTCAGGG + Intergenic
1197449599 X:126594996-126595018 CATGGTGCCAAGAGCATTTCTGG - Intergenic
1197808732 X:130422353-130422375 GAAGGGGTCAAGAGGATTCCTGG + Intergenic
1199248851 X:145637135-145637157 GATGGAGCTATGTGGATTCCTGG + Intergenic
1199264985 X:145818595-145818617 GAGGGGGCTAAGAGGAGTCCGGG - Exonic
1199944902 X:152657605-152657627 GATGGAAGCCAGAGGTTTCCTGG - Intergenic
1200887329 Y:8282225-8282247 GAGGGAGCAAAGAGGAGGCCAGG + Intergenic
1201633153 Y:16092413-16092435 GACTGAGGCAAGAGGATTACTGG + Intergenic