ID: 1180916616

View in Genome Browser
Species Human (GRCh38)
Location 22:19493205-19493227
Sequence CTAGACAGAGCAGCTTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180916612_1180916616 -10 Left 1180916612 22:19493192-19493214 CCCAGTCCTTTGACTAGACAGAG 0: 2
1: 1
2: 8
3: 67
4: 339
Right 1180916616 22:19493205-19493227 CTAGACAGAGCAGCTTTTGTGGG 0: 1
1: 0
2: 2
3: 13
4: 158
1180916611_1180916616 -6 Left 1180916611 22:19493188-19493210 CCTTCCCAGTCCTTTGACTAGAC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1180916616 22:19493205-19493227 CTAGACAGAGCAGCTTTTGTGGG 0: 1
1: 0
2: 2
3: 13
4: 158
1180916609_1180916616 24 Left 1180916609 22:19493158-19493180 CCTAAAAGCTTTCTGTCTTGGGA 0: 1
1: 0
2: 0
3: 26
4: 504
Right 1180916616 22:19493205-19493227 CTAGACAGAGCAGCTTTTGTGGG 0: 1
1: 0
2: 2
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180916616 Original CRISPR CTAGACAGAGCAGCTTTTGT GGG Intronic
900366187 1:2312866-2312888 GTAGACAGGGCAGTTTCTGTGGG - Intergenic
906950613 1:50332357-50332379 CATGACAGAGGAGGTTTTGTCGG + Intergenic
907205637 1:52768195-52768217 CTAGAGAGAGCAGATTTTGGGGG + Intronic
907642685 1:56206948-56206970 CTTTAAAGAGTAGCTTTTGTAGG - Intergenic
909903915 1:81173748-81173770 CTGTACAGAATAGCTTTTGTAGG + Intergenic
914984982 1:152448682-152448704 CTCCACAGAGCAGCCTTTCTGGG + Intergenic
916336285 1:163674276-163674298 AAAGACAAAGCAGATTTTGTAGG - Intergenic
919658984 1:200224578-200224600 CTTAACAGAACTGCTTTTGTGGG + Intergenic
920542382 1:206788939-206788961 CTAGGCAGAGGAGCTTTCCTGGG + Intergenic
921353228 1:214259391-214259413 CTAGGTAGAGCAGATTTTGAGGG - Intergenic
922010128 1:221575165-221575187 CTAGACAGGGAAGCTATTGGTGG - Intergenic
922577136 1:226668770-226668792 ATAGACAAAGCCGCATTTGTTGG - Intronic
923648068 1:235845010-235845032 CTGGACAGAGCAGCATGTGGTGG + Intronic
923808811 1:237289268-237289290 CTAGACAGAGCAGTATGTGGGGG - Intronic
1063280834 10:4627832-4627854 TCAGACAGAGCAGCTTTTGAAGG + Intergenic
1064605830 10:17037838-17037860 CTGGTCAGAGCAGTGTTTGTGGG - Intronic
1065907395 10:30269996-30270018 AAAGACAGAGAAGCATTTGTTGG + Intergenic
1066320223 10:34295608-34295630 CCAGTCAGAGCTGCTTTTGCAGG + Intronic
1069182512 10:65379635-65379657 TAAAACAGAGTAGCTTTTGTTGG - Intergenic
1072030879 10:91521225-91521247 ATAGGCAAAGCAGTTTTTGTGGG + Intergenic
1075422052 10:122308965-122308987 CTGGGCAGAGCAGCTCTGGTGGG - Intronic
1075880749 10:125848694-125848716 CTAGAAAGAGCAGTTTTAATGGG - Intronic
1075982903 10:126756364-126756386 CTGGACAGAGCAGCGTGTGAAGG - Intergenic
1077048560 11:556589-556611 CTAGAGAGAGCAGCGCTTTTGGG + Intronic
1079156466 11:17952764-17952786 CTTGAGAGAGCAGCTTCAGTGGG - Intronic
1079273819 11:19014191-19014213 CTGGACAGAGCAGCATGTGGAGG - Intergenic
1083990020 11:66241273-66241295 CCACACAGAGCAGCTCATGTAGG - Intronic
1084365584 11:68695703-68695725 CTAGAGAGGGCAGCTTTTGTTGG - Intergenic
1085542131 11:77281446-77281468 CTAGAAAGAGCAGAATTTTTTGG - Intronic
1089597736 11:119592356-119592378 ATAGGCAGAGCAGCCTTTGAGGG - Intergenic
1095931726 12:47634780-47634802 CTAGAGAGAGCAGGCTTTGGGGG - Intergenic
1096474736 12:51901402-51901424 CTGGACAGGGCAGCTTTTGTTGG - Intergenic
1099473180 12:83075338-83075360 CCAGACAGAGCAGCTTGCGGAGG - Intronic
1112602101 13:100867452-100867474 CTTTACAGAGTGGCTTTTGTAGG + Intergenic
1112846454 13:103648870-103648892 CTAGAAAGAGCAGCTTCCTTTGG + Intergenic
1114515166 14:23294665-23294687 CCAGCCGGAGCAGCTTTTGTAGG - Intronic
1115583463 14:34786167-34786189 GCAGACAGTGCAGATTTTGTGGG + Exonic
1116153506 14:41173061-41173083 CTAGACACAGAAGTTTTTGAGGG - Intergenic
1118537392 14:66783057-66783079 CTAGACAAACAGGCTTTTGTAGG - Intronic
1118824686 14:69369469-69369491 CAAGACAGAGCTGCTTTGGATGG + Intergenic
1120777480 14:88453447-88453469 AAGAACAGAGCAGCTTTTGTGGG + Intronic
1120868804 14:89318941-89318963 CCAGACAGAGAAGCTATTGCAGG + Intronic
1122422790 14:101588016-101588038 CTAGAGACAGGGGCTTTTGTTGG - Intergenic
1122644345 14:103183266-103183288 ATAAACAGAGCAGATTTTATTGG - Intergenic
1122893037 14:104741822-104741844 CAAGACAGAGCAGGTTTAGGGGG - Intronic
1124035869 15:26053220-26053242 CTAGTCAGAGCTGCTGTTGCTGG + Intergenic
1125279062 15:38025298-38025320 CTAGACAGAGTAACCTTTTTGGG + Intergenic
1126341156 15:47642529-47642551 CTAGACAGTGAAGCCTTTGAGGG - Intronic
1130662310 15:85840337-85840359 GAAGACAAAGCAGCTTTTTTGGG - Intergenic
1130716654 15:86341282-86341304 CTAGACAGAGCAGGCTTTTATGG + Intronic
1132783392 16:1641324-1641346 CTGGACCAAGCACCTTTTGTTGG - Intronic
1135961938 16:27002254-27002276 CTAGACAGTGCAGGGTTGGTGGG + Intergenic
1137338890 16:47578916-47578938 CTAGAGAGACAGGCTTTTGTTGG + Intronic
1138085748 16:54132246-54132268 CTAGACAGAGCCTTCTTTGTGGG - Intergenic
1138747815 16:59384013-59384035 CTAAAAAGAGCCGCTTTTGTAGG - Intergenic
1141876196 16:86826193-86826215 CCAGACAGAGCACCTGGTGTGGG + Intergenic
1148187301 17:45654007-45654029 CTAGACAGAGGAGGCTTTATTGG - Intergenic
1149368591 17:55970207-55970229 CCAGACAGTGCAGATTTTGAAGG + Intergenic
1152112778 17:78366292-78366314 TCGGACAGAGCAGCATTTGTCGG - Intergenic
1152298306 17:79481139-79481161 CTGGAAAGAGCATCTTTTGATGG + Intronic
1154079251 18:11238160-11238182 TTACACAGAGAAGCTTTTATAGG + Intergenic
1158004160 18:52652845-52652867 ATAGGCAGAGGAGCTTTCGTGGG + Intronic
1163413759 19:17172983-17173005 CTCGACAGTGACGCTTTTGTGGG - Intronic
1164573345 19:29389919-29389941 CTAGAGAGTGCAGCTTTTGGAGG - Intergenic
1167538824 19:50072572-50072594 CTATAGAGAGCAGCCTCTGTCGG + Intergenic
926006678 2:9378300-9378322 CAAGCCTGAGCACCTTTTGTGGG + Intronic
926551027 2:14300831-14300853 CTAGAAAGAGCAGGTGTTGATGG - Intergenic
927416894 2:22889426-22889448 CTAGGCAGGGCTGCCTTTGTGGG - Intergenic
931128658 2:59306405-59306427 CTGCACAGAGCACATTTTGTTGG - Intergenic
933718094 2:85376773-85376795 CTAGAGAGAGCAGCTTTCCTTGG + Intronic
933969979 2:87462433-87462455 CTAGAGAGACCAGCCTATGTTGG - Intergenic
935275188 2:101470337-101470359 CTACACAGAGCACCTGCTGTAGG + Intronic
936323802 2:111488063-111488085 CTAGAGAGACCAGCCTATGTTGG + Intergenic
936849194 2:116874656-116874678 CTAGAAAGAGCAGTGTTTGGAGG - Intergenic
937069392 2:119051108-119051130 CCAGACAGAGCAGCATGTGGAGG - Intergenic
939109609 2:137991836-137991858 CTAGAAACAGCAGCGTTTGGAGG + Intronic
941679654 2:168383710-168383732 CTGGACAGAGCAGCATGTGGAGG + Intergenic
942330293 2:174816505-174816527 CTAGAAAGAGCAGCCTTTTTTGG + Intronic
1169336342 20:4760259-4760281 CTGGACAGAGCAGCATGTGGGGG - Intergenic
1172477011 20:35246650-35246672 CTCCAGAGAGCAGCTTTTATTGG - Intronic
1172899726 20:38325705-38325727 CTATACAGAGAAGCTCTGGTTGG + Intronic
1175068929 20:56315720-56315742 CCAGACAGAGCAGCTTGCGGAGG + Intergenic
1175660601 20:60808927-60808949 CTGGGCAGAGCCCCTTTTGTGGG + Intergenic
1176246772 20:64101171-64101193 CAAAACAGAGCAGCTTTGGAGGG + Intergenic
1176519737 21:7815648-7815670 CTAGACAGAGCAGGGAATGTGGG - Intergenic
1176519801 21:7815967-7815989 CTAGACAGAGCAGGGAATGTGGG - Intergenic
1177910229 21:27022050-27022072 CTGTAAAGAGCAACTTTTGTAGG - Intergenic
1178653765 21:34445661-34445683 CTAGACAGAGCAGGGAATGTGGG - Intergenic
1178653829 21:34445980-34446002 CTAGACAGAGCAGGGAATGTGGG - Intergenic
1180916616 22:19493205-19493227 CTAGACAGAGCAGCTTTTGTGGG + Intronic
1180944116 22:19680333-19680355 CTAGACACAGCAGCTTTCATTGG - Intergenic
1184755761 22:46514957-46514979 TTGGACAGAGCCACTTTTGTGGG - Intronic
1185265450 22:49900194-49900216 CTAGACGGAGCATTCTTTGTAGG - Intergenic
951036157 3:17934544-17934566 CTAGACAGAGAAGCTCTGGATGG + Intronic
954967420 3:54623869-54623891 CTGGACAGAGCAGCTCTTAGTGG + Intronic
955336249 3:58088657-58088679 CTGGACAGGGGAGCTTTTGTTGG - Intronic
959793550 3:110394245-110394267 CTAGCCAGATCAGCCTTGGTGGG + Intergenic
959794270 3:110404644-110404666 CTACCCAGAGCATGTTTTGTTGG - Intergenic
960250796 3:115450342-115450364 CTAGACAGGGCACTTTATGTTGG + Intergenic
960629120 3:119711264-119711286 CTAGACAGAGCAACTTCTTGGGG + Intronic
961529160 3:127529441-127529463 CTAGAGGGAGCAGGTTTTTTTGG - Intergenic
961693918 3:128690815-128690837 CTAGACAGAGTAACTTTTCTAGG + Intergenic
963544904 3:146644228-146644250 CTAGACAGTGCTGCTTTAGAAGG + Intergenic
964160499 3:153640266-153640288 CCAGACAGAGCAGCATGTGGAGG + Intergenic
964917621 3:161855289-161855311 CTGGACAGAGCAGCATGTGGAGG - Intergenic
965660500 3:171036797-171036819 CTAGGGAGAGCAGGTTTTGAGGG + Intergenic
967389266 3:188939451-188939473 TCAGACAGAGCAGCTGTGGTGGG - Intergenic
967745657 3:193052134-193052156 CTAGACCTAGCAGATATTGTTGG - Intergenic
968193541 3:196688758-196688780 CTGGACATAGGAGCATTTGTTGG - Intronic
968552246 4:1229671-1229693 CTGGGCAGAGCAGCTGGTGTTGG + Intronic
970869664 4:20800289-20800311 CTTTACAGAGTAGCTTTTGTAGG - Intronic
973144709 4:46811769-46811791 CTTTACAGAGCAGCTTTCATAGG + Intronic
975755112 4:77564224-77564246 CTAGAAACTCCAGCTTTTGTTGG - Intronic
976711640 4:88078260-88078282 GTAGACAAAGCAGCCTTTGCTGG + Intergenic
977663398 4:99616833-99616855 TTAGACAACGCACCTTTTGTGGG - Intronic
978345259 4:107760604-107760626 CTAGATAGTGCAAATTTTGTTGG - Intergenic
983175656 4:164585504-164585526 CCAGACAGAGCAGCGTGTGGAGG - Intergenic
989550313 5:42727165-42727187 GTAGAAAGAGAAGCTATTGTAGG + Intergenic
990384627 5:55247858-55247880 CAAAACAGAGCAGCTGTTGAGGG + Intergenic
990776352 5:59309723-59309745 CTGGACAGAGCAGCATGTGGAGG - Intronic
991207694 5:64068133-64068155 CTAGACAGAGCAGATTTATCTGG - Intergenic
994822788 5:104676000-104676022 ATAGACAGAGCAGCCTGTGGTGG + Intergenic
995281024 5:110335935-110335957 TAAGACAGAGCAGATTATGTTGG + Intronic
998797543 5:145835574-145835596 CCAGGCAGAGAAGCTTTTCTCGG - Intergenic
1000051033 5:157563126-157563148 CTAGACAGTGCAGCGTCTATTGG - Intronic
1001259848 5:170219119-170219141 CAAAACAGAGCAGTTTTTGCAGG - Intergenic
1002116795 5:176968584-176968606 CTTGAAAGAGAAACTTTTGTTGG - Exonic
1003450735 6:6229620-6229642 CTGGACAGAGCAGCATGTGGAGG + Intronic
1004565424 6:16791654-16791676 CTAAAGAGAGCAGATTTTATGGG - Intergenic
1004904160 6:20220865-20220887 CAAGACAGAGTGGCTTTGGTGGG - Intergenic
1008115498 6:47545189-47545211 ATAGACAGAGCAGCATGTGGAGG + Intronic
1011233195 6:85187174-85187196 CTGGACAGAGCAGCATATGGAGG + Intergenic
1012127242 6:95445619-95445641 TTATTCAGAGCAGCTTTTCTGGG - Intergenic
1012368088 6:98467408-98467430 CTTCACAGAGAAGCTCTTGTAGG - Intergenic
1014126593 6:117783296-117783318 CTAGCCACTGCAGCTCTTGTTGG - Intergenic
1015474584 6:133646192-133646214 CTACACAGTGCAGCTGTTCTTGG + Intergenic
1015945084 6:138491206-138491228 GTTCACAGAGCAGCTGTTGTTGG - Intronic
1017680655 6:156861100-156861122 GTAGACAGAGGAGCCTTTGCAGG + Intronic
1024545337 7:50513005-50513027 CTGGACAGAGCAGCGTGTGGAGG + Intronic
1028183116 7:87748450-87748472 CTAGACAGAGCAGCCTGCGGAGG - Intronic
1028936827 7:96474273-96474295 ACAGACAGAGCAGCTTGTGGAGG - Intergenic
1029239552 7:99149718-99149740 CTAGACAGAGAAGATTTTAAAGG - Intergenic
1031011584 7:116529317-116529339 TTGGACAGAGCAGCTTTTACAGG - Intronic
1031387014 7:121163653-121163675 CTAGACAGAGCAGGATTACTTGG + Intronic
1032587569 7:133161714-133161736 CTAGACAGAGCAGGTTGAGCAGG - Intergenic
1033444246 7:141406154-141406176 CTAGACAAATCAGATTTTGGAGG - Intronic
1036227376 8:6971099-6971121 CCAGGCAGGGCAGGTTTTGTTGG + Intergenic
1037748927 8:21667440-21667462 GAGGACAGAGCAGCTTTTGCTGG - Intergenic
1037961235 8:23099827-23099849 CTAGACAGAACAGCTCTTATTGG + Intronic
1037970443 8:23168030-23168052 CTAGACAGAACAGCTCTTATTGG - Intergenic
1041509030 8:58633837-58633859 CTTGAAAGAGTAGCTTGTGTCGG + Intronic
1045779692 8:105849004-105849026 CTGGACAGATCAGCATTTGGAGG + Intergenic
1047038647 8:120968243-120968265 CTAGACAGAAAAGCTCTTGAGGG - Intergenic
1047130897 8:122018257-122018279 CCAGACAGAGCAGCTTGCGGAGG - Intergenic
1047200376 8:122760269-122760291 GTAGACAGAACATCTGTTGTTGG - Intergenic
1048514844 8:135097027-135097049 CTACAGAGAGAAGATTTTGTTGG - Intergenic
1051773614 9:20609030-20609052 CTTGACAGAGTATCTTTTTTAGG - Intronic
1052681432 9:31698219-31698241 GTAGGCAGAGCAACATTTGTTGG + Intergenic
1055982515 9:82018714-82018736 CTAGAGAGAGTAGGTTTTTTGGG + Intergenic
1057711929 9:97453395-97453417 CTAGAAGCAGCAGCTTTTGGAGG + Intronic
1058085176 9:100740534-100740556 CCAGACAGAGCAGCGTGTGGAGG - Intergenic
1058864488 9:109149070-109149092 CTAGACAGCTCAGCTTCTTTGGG - Intronic
1059967557 9:119630656-119630678 CTAGCTAGAGCAGATTATGTTGG + Intergenic
1061395828 9:130342857-130342879 CTGGCCAAAGCAGCTTTTCTGGG + Intronic
1186742849 X:12535967-12535989 CAAGACAGAGAGACTTTTGTGGG + Intronic
1189962011 X:46333126-46333148 CCAGACAGAGCAGCATGTGGAGG + Intergenic
1192914649 X:75639044-75639066 CTGGACAGAGCAGCATGTGGAGG - Intergenic
1193062631 X:77222717-77222739 CCAGACAGAGCAGCATGTGGCGG + Intergenic
1193420663 X:81279359-81279381 CCAGACAGAGCAGCATCTGGAGG + Intronic
1194743118 X:97598902-97598924 CTATATACAGCACCTTTTGTTGG - Intronic
1195898759 X:109775094-109775116 CAAGACAGACCAGCTCTTGGTGG - Intergenic
1196209889 X:112984195-112984217 CTGTACAGTGCAGCTTTTGATGG + Intergenic
1199058002 X:143319888-143319910 CTGGACAGAGCAGCGTGTGGAGG - Intergenic
1199833693 X:151567556-151567578 CTAGAGACAGCAGCTTTTTATGG - Intronic