ID: 1180917484

View in Genome Browser
Species Human (GRCh38)
Location 22:19499229-19499251
Sequence TTTTTAGCAGGGTCCCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180917479_1180917484 -9 Left 1180917479 22:19499215-19499237 CCATAGCCACTAAGTTTTTAGCA 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1180917484 22:19499229-19499251 TTTTTAGCAGGGTCCCTGTAGGG 0: 1
1: 0
2: 1
3: 13
4: 108
1180917475_1180917484 21 Left 1180917475 22:19499185-19499207 CCCTGTGCTGTGGCCAGGTGCAC 0: 1
1: 0
2: 4
3: 23
4: 229
Right 1180917484 22:19499229-19499251 TTTTTAGCAGGGTCCCTGTAGGG 0: 1
1: 0
2: 1
3: 13
4: 108
1180917478_1180917484 -4 Left 1180917478 22:19499210-19499232 CCTGACCATAGCCACTAAGTTTT 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1180917484 22:19499229-19499251 TTTTTAGCAGGGTCCCTGTAGGG 0: 1
1: 0
2: 1
3: 13
4: 108
1180917476_1180917484 20 Left 1180917476 22:19499186-19499208 CCTGTGCTGTGGCCAGGTGCACA 0: 1
1: 0
2: 2
3: 26
4: 249
Right 1180917484 22:19499229-19499251 TTTTTAGCAGGGTCCCTGTAGGG 0: 1
1: 0
2: 1
3: 13
4: 108
1180917477_1180917484 8 Left 1180917477 22:19499198-19499220 CCAGGTGCACAGCCTGACCATAG 0: 1
1: 0
2: 0
3: 18
4: 117
Right 1180917484 22:19499229-19499251 TTTTTAGCAGGGTCCCTGTAGGG 0: 1
1: 0
2: 1
3: 13
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180917484 Original CRISPR TTTTTAGCAGGGTCCCTGTA GGG Intronic
900537766 1:3187291-3187313 TTTTTGGCAGGGCCCCTGCCTGG + Intronic
902187561 1:14736622-14736644 TTTTTAACAGGGTCCCCAGATGG + Intronic
903750786 1:25619023-25619045 TCTTGAGCTGGTTCCCTGTAGGG + Intronic
904616711 1:31753949-31753971 TTTTAGGGAGGGCCCCTGTAGGG - Intronic
909799995 1:79795491-79795513 TTTTTAGTAGTGTCCTTGTCTGG + Intergenic
910908395 1:92207639-92207661 TTTTTTGCAGTGTCCTTGTCTGG + Intergenic
916212912 1:162373062-162373084 TTTGTGCCAGGGTCCCTGCAAGG + Intronic
917440866 1:175067729-175067751 CTTTTAGCAGAGTCCCTGCTAGG + Intergenic
917736750 1:177928186-177928208 ATTTTTGCAATGTCCCTGTAGGG + Intronic
921430315 1:215057869-215057891 TTTCTTGCAGCTTCCCTGTAAGG - Intronic
921638087 1:217521342-217521364 TTTTTTGCAGTCTCCCTGTAGGG - Intronic
1063870536 10:10412238-10412260 TTTTCAGCTGGGTCCCTCCATGG + Intergenic
1064153497 10:12884987-12885009 ATATTTGCAGGCTCCCTGTAAGG + Intergenic
1064913329 10:20427470-20427492 TTTTTCCCAGGGTCCCTGCCTGG - Intergenic
1067044354 10:42975981-42976003 TTTTTACCAGGCTGCCTGTAAGG + Intergenic
1068782067 10:60930682-60930704 TTTTTAGGAGGTTCACTGTAAGG - Intronic
1068888858 10:62127326-62127348 TTTCTTGCAGGGTCCCAGAATGG + Intergenic
1069824206 10:71245433-71245455 TCTTTAGCAGAATCCCAGTAGGG + Intronic
1070404067 10:76078988-76079010 TGTTTATCAGGGTCCTTGGAAGG + Intronic
1074313401 10:112341574-112341596 TCTATAGTAGGGTCTCTGTATGG - Intergenic
1079371292 11:19855230-19855252 TTTCTGGCAAGGTCTCTGTATGG + Intronic
1082091857 11:48096840-48096862 TTTTTACCAAGTTCCCTGGATGG + Intronic
1087351390 11:97037366-97037388 TTTTTAGCAGTTTCTGTGTATGG + Intergenic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1091607521 12:1967898-1967920 TTTTTTGCAGTGTCCATCTATGG - Exonic
1094759070 12:33508280-33508302 TTTATAGTAGTGTCCCTGTCTGG - Intergenic
1096547549 12:52351034-52351056 TTTCTAGCTGGGTCCCTTCAGGG + Intergenic
1097404092 12:59167456-59167478 TCTTTAACAGGGTCAATGTATGG + Intergenic
1097643769 12:62211802-62211824 TTTTTATCAGGTTCCATATATGG + Intronic
1100467900 12:94864297-94864319 TTTTTTGCTGGGTCCTTGTCTGG - Intergenic
1101839582 12:108318507-108318529 TTGTTTGCAGGGTCACTGTGGGG + Intronic
1104099809 12:125596566-125596588 TTTTGAGGAGGGGCCCTTTAAGG - Intronic
1107723103 13:43270145-43270167 TTTTAAGCAGGGCCACTGTATGG + Intronic
1107881628 13:44837146-44837168 TTTCTAGCTGTGTCCCTGCATGG + Intergenic
1115344927 14:32332508-32332530 TTTCTAGCAGGATCTCTGTATGG + Intronic
1120941344 14:89953238-89953260 TTTTTAGCCAGGTTCCTGTCTGG - Intronic
1121787639 14:96674376-96674398 CTTTCAGCAGGGTCTCTGGAGGG - Intergenic
1129314422 15:74732603-74732625 TTTTTAACAGGGACCTTCTATGG - Intergenic
1130134238 15:81168626-81168648 TTTTGAGCTGGGTGCCTGGACGG + Intronic
1137591073 16:49694290-49694312 TTTTTAGAGGGGTCTCTGTATGG - Intronic
1138395148 16:56698353-56698375 TTTTTTGATGGGTTCCTGTAGGG - Intronic
1142474105 17:179863-179885 GTTAGAGCAGGGCCCCTGTAGGG - Intronic
1145208958 17:20999216-20999238 TTTGTAGCAAGCTCCCTGTGTGG - Intergenic
1146132835 17:30293092-30293114 TTTTTAGCCGAGTCTCTCTAGGG - Intergenic
1150621263 17:66809355-66809377 TTTTGTGTAGGGTCACTGTAAGG - Exonic
1151849121 17:76679433-76679455 TTTTTAACAGGGTGGATGTATGG + Intronic
1157238445 18:45986065-45986087 ATTTAAACAGGGTCCCGGTACGG - Intronic
1160052467 18:75447776-75447798 CTTTTATAAGGGTACCTGTAAGG - Intergenic
1163356456 19:16815020-16815042 CTGTCAGCAGGGTGCCTGTAAGG - Exonic
1165869624 19:38962089-38962111 TTTTTAACAGCGTCCCTGGGTGG - Intronic
927914973 2:26929816-26929838 TCTTTAGCAGGGGGACTGTAGGG - Intronic
928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG + Intronic
928992757 2:37252234-37252256 TTTTTAGCAGGGCCAGTGCAGGG - Exonic
931226714 2:60338057-60338079 TTCTTTCCAGGGTCCCTGGAAGG + Intergenic
933798226 2:85938237-85938259 TTGTTAGCAAGGTCAGTGTAGGG - Intergenic
937604632 2:123783702-123783724 TTTTTAACAGATTCACTGTAGGG - Intergenic
939766929 2:146262504-146262526 TTTTGATCAGGGTCCTTGTGGGG + Intergenic
943916461 2:193640574-193640596 TTTTTTGTAGTGTCCTTGTATGG + Intergenic
947475853 2:230447161-230447183 AATTTAGAAAGGTCCCTGTAGGG + Intronic
948099753 2:235364503-235364525 TTTTTAGCAGGGGCCAGGTTGGG + Intergenic
1169480753 20:5978352-5978374 TTTGTAGTAAGCTCCCTGTATGG + Intronic
1173471549 20:43327139-43327161 CTCTTAGCAGGGTCCCAATAGGG - Intergenic
1177460732 21:21406322-21406344 TCTTTAGCAAGGACCCTGTTAGG - Intronic
1180522228 22:16219955-16219977 TATGGAGCAGGGTCCCTGAACGG + Intergenic
1180917484 22:19499229-19499251 TTTTTAGCAGGGTCCCTGTAGGG + Intronic
1181771684 22:25130566-25130588 TTTTTAGCAATTTGCCTGTATGG - Intronic
949649142 3:6134894-6134916 TGTGCAGCAGGGTGCCTGTAGGG - Intergenic
950073393 3:10170271-10170293 TAATTACCAGGGTCCCTGTAAGG - Intronic
962511678 3:136107069-136107091 TTCTTAACATGGTCCCTTTATGG - Intronic
965327875 3:167330405-167330427 TTTTTAGCTGGGAGCCTATATGG + Intronic
965409209 3:168308542-168308564 TTCCTAGCAGGGTCCGTGCATGG + Intergenic
967213045 3:187185677-187185699 TCTTTAGCAGGGTACCTGCTTGG + Intergenic
967857737 3:194131019-194131041 TTTTTCTCACGGTCCCTGAAAGG + Intergenic
969528163 4:7714692-7714714 CTTTCAGCAGAGTCCCTGGATGG - Intronic
972718159 4:41669457-41669479 TGTGTGCCAGGGTCCCTGTAGGG + Intronic
974277174 4:59737599-59737621 TTTTGAGCAGGGGGCCTGTAAGG - Intergenic
975949484 4:79751338-79751360 TTTTTTGCAGTGTCCTTGTTTGG - Intergenic
985986950 5:3523788-3523810 TTTTCAGCAGAGTCCCTCTGAGG - Intergenic
989370618 5:40703584-40703606 TTTTTAGAATAGTTCCTGTAGGG - Intergenic
990445295 5:55888330-55888352 TTTTAATCAAGGTGCCTGTAAGG - Intronic
991479278 5:67059695-67059717 TTTTTAAAAGGGTTTCTGTAAGG + Intronic
991534202 5:67648725-67648747 CTTTTAGCTGGGTCCCTGCATGG + Intergenic
992995013 5:82323990-82324012 CTTTTATAAGGGTCCCAGTAGGG - Intronic
996070462 5:119125435-119125457 ATTTTAGCAGGGCCACTATATGG + Intronic
999652102 5:153777749-153777771 TTTTTAGCATGTTCTCTGTGGGG - Intronic
1004682980 6:17914673-17914695 TGTGGAGCAGGGTCTCTGTAGGG + Intronic
1005561058 6:27041221-27041243 TTTTTAGCAGACTCCTTGAAGGG + Intergenic
1007658385 6:43466934-43466956 TCTCTAACAGGGTCCCTGTGAGG + Intergenic
1010354953 6:74921841-74921863 TTTTGTGCATGGTCCTTGTAAGG - Intergenic
1011757301 6:90513482-90513504 TTTTTAGTAGGTTCTGTGTAAGG + Intergenic
1013622178 6:111900533-111900555 ATTTTAGCAGGCTCTCTGAAAGG - Intergenic
1015855199 6:137617012-137617034 TGTTTAGCAGTGTCCCAGTTTGG + Intergenic
1016242051 6:141941890-141941912 TGTCTAGCAGGGTTTCTGTAGGG - Intergenic
1019292220 7:256394-256416 TTTTTTGCAGAGTCTCTGTGGGG - Intronic
1022749367 7:33207695-33207717 TTTCTAGCACTGTCCCTGAAAGG - Intronic
1026004478 7:66590353-66590375 TTTTTAGCTGGGTCCTTTTATGG - Intergenic
1026013802 7:66656500-66656522 TTTTTAGCTGGGTCCCTGTGTGG + Intronic
1026017769 7:66684124-66684146 TTTTTAGCTGGGTCCTTATGTGG + Intronic
1026025860 7:66742988-66743010 TTTTTAGCTGGGTCCTTGTGTGG + Intronic
1026461930 7:70622023-70622045 TTTTTAGTAGAGACCCTGTTGGG + Intronic
1027906048 7:84183957-84183979 TTTTAAGCAGATTCCATGTAAGG - Intronic
1032362273 7:131267016-131267038 TTCTTAGAAGAGTCCCTGTGAGG - Intronic
1034228322 7:149499590-149499612 TTTTTAACAAGTTCCTTGTAGGG + Intergenic
1034978524 7:155461434-155461456 TTTTGGACAGGGTCGCTGTAAGG - Intronic
1035436646 7:158864428-158864450 TTTATGGCAGTGTCCCTGGAAGG + Intronic
1035467834 7:159091318-159091340 TTCTGAGCCGTGTCCCTGTATGG + Intronic
1037441615 8:18922125-18922147 TTTTTAGCAGTCTCCCTTCATGG - Intronic
1037769698 8:21791050-21791072 TTTGGAGCAGGGTCCTTGGAAGG - Intronic
1046753741 8:117952375-117952397 TGTTTAGCAGGCTACCTGGAAGG - Intronic
1047746071 8:127845967-127845989 TTCTTAGCGGGGTCCCAGGAAGG + Intergenic
1051320207 9:15895094-15895116 TTTTTAGCAATGTGCCTGTAAGG + Intronic
1052747398 9:32453669-32453691 TTTTTAGCAGTTTCCCTTTCAGG + Exonic
1058761332 9:108136230-108136252 GTTCTAGCAGGGTCCCTCAAAGG + Intergenic
1061602365 9:131679649-131679671 AGTTTAGCTGGGTCCCTGAAAGG + Intronic
1185632812 X:1527929-1527951 GAATGAGCAGGGTCCCTGTAGGG - Intronic
1186819336 X:13270912-13270934 TTTTAAGAAGGGTTCCTGTTTGG - Intergenic
1189708951 X:43789312-43789334 TTTTTAACAGTGGCCCTCTAGGG + Intronic
1190471658 X:50786561-50786583 TTCTTAGCAGGGTAACTGCAAGG - Intronic
1191671707 X:63754661-63754683 TTTCTAGCATGGTGGCTGTATGG - Exonic
1192803510 X:74490594-74490616 TTTTTTGGGGGTTCCCTGTAGGG + Intronic
1192962851 X:76148525-76148547 TTTGTTGTAGGTTCCCTGTAGGG + Intergenic
1199193761 X:145003102-145003124 TTTTTTGGAGGTTCCCTGTAGGG + Intergenic
1199487403 X:148363034-148363056 TTTTAAGCAGTGTGGCTGTATGG + Intergenic