ID: 1180917765

View in Genome Browser
Species Human (GRCh38)
Location 22:19500700-19500722
Sequence GCTTTTAGGGAGACTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3023
Summary {0: 1, 1: 0, 2: 3, 3: 117, 4: 2902}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180917765_1180917771 -1 Left 1180917765 22:19500700-19500722 CCCTCCACAGTCTCCCTAAAAGC 0: 1
1: 0
2: 3
3: 117
4: 2902
Right 1180917771 22:19500722-19500744 CCCCAGCCCAAAACTCCTCAAGG 0: 1
1: 10
2: 39
3: 84
4: 397
1180917765_1180917775 5 Left 1180917765 22:19500700-19500722 CCCTCCACAGTCTCCCTAAAAGC 0: 1
1: 0
2: 3
3: 117
4: 2902
Right 1180917775 22:19500728-19500750 CCCAAAACTCCTCAAGGAGATGG 0: 1
1: 2
2: 24
3: 66
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180917765 Original CRISPR GCTTTTAGGGAGACTGTGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr