ID: 1180921654

View in Genome Browser
Species Human (GRCh38)
Location 22:19524473-19524495
Sequence ATTGGCTGCTTCGGGCCGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180921654_1180921666 21 Left 1180921654 22:19524473-19524495 CCCCCCGGCCCGAAGCAGCCAAT 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1180921666 22:19524517-19524539 GCAGCCAATCACAGAGCCTCTGG 0: 1
1: 0
2: 10
3: 548
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180921654 Original CRISPR ATTGGCTGCTTCGGGCCGGG GGG (reversed) Exonic