ID: 1180927799

View in Genome Browser
Species Human (GRCh38)
Location 22:19568154-19568176
Sequence TGACCTGGACCTAGGGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180927789_1180927799 11 Left 1180927789 22:19568120-19568142 CCCTGTGATGTTGAGGATTACAG No data
Right 1180927799 22:19568154-19568176 TGACCTGGACCTAGGGGTGAGGG No data
1180927790_1180927799 10 Left 1180927790 22:19568121-19568143 CCTGTGATGTTGAGGATTACAGC No data
Right 1180927799 22:19568154-19568176 TGACCTGGACCTAGGGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180927799 Original CRISPR TGACCTGGACCTAGGGGTGA GGG Intergenic