ID: 1180927799 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:19568154-19568176 |
Sequence | TGACCTGGACCTAGGGGTGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1180927789_1180927799 | 11 | Left | 1180927789 | 22:19568120-19568142 | CCCTGTGATGTTGAGGATTACAG | No data | ||
Right | 1180927799 | 22:19568154-19568176 | TGACCTGGACCTAGGGGTGAGGG | No data | ||||
1180927790_1180927799 | 10 | Left | 1180927790 | 22:19568121-19568143 | CCTGTGATGTTGAGGATTACAGC | No data | ||
Right | 1180927799 | 22:19568154-19568176 | TGACCTGGACCTAGGGGTGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1180927799 | Original CRISPR | TGACCTGGACCTAGGGGTGA GGG | Intergenic | ||