ID: 1180933762

View in Genome Browser
Species Human (GRCh38)
Location 22:19610776-19610798
Sequence CTGCTAAGGAGCAGAAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180933762_1180933770 15 Left 1180933762 22:19610776-19610798 CCCCCACTTCTGCTCCTTAGCAG No data
Right 1180933770 22:19610814-19610836 TTGCATCACAGTGGGCCATGTGG No data
1180933762_1180933768 6 Left 1180933762 22:19610776-19610798 CCCCCACTTCTGCTCCTTAGCAG No data
Right 1180933768 22:19610805-19610827 GTTCTCATTTTGCATCACAGTGG No data
1180933762_1180933769 7 Left 1180933762 22:19610776-19610798 CCCCCACTTCTGCTCCTTAGCAG No data
Right 1180933769 22:19610806-19610828 TTCTCATTTTGCATCACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180933762 Original CRISPR CTGCTAAGGAGCAGAAGTGG GGG (reversed) Intergenic
No off target data available for this crispr