ID: 1180935167

View in Genome Browser
Species Human (GRCh38)
Location 22:19620670-19620692
Sequence CTGAGGGCATGGCGAGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180935160_1180935167 -6 Left 1180935160 22:19620653-19620675 CCCAGAGGGATGACCCTCTGAGG No data
Right 1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG No data
1180935162_1180935167 -7 Left 1180935162 22:19620654-19620676 CCAGAGGGATGACCCTCTGAGGG No data
Right 1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180935167 Original CRISPR CTGAGGGCATGGCGAGAAGA CGG Intergenic
No off target data available for this crispr