ID: 1180938129

View in Genome Browser
Species Human (GRCh38)
Location 22:19639366-19639388
Sequence ATAAACAGCATGATTATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180938129_1180938136 20 Left 1180938129 22:19639366-19639388 CCTGGCATAATCATGCTGTTTAT No data
Right 1180938136 22:19639409-19639431 CTTGGGAGGCCAGGCTGGCTGGG No data
1180938129_1180938134 15 Left 1180938129 22:19639366-19639388 CCTGGCATAATCATGCTGTTTAT No data
Right 1180938134 22:19639404-19639426 GATATCTTGGGAGGCCAGGCTGG No data
1180938129_1180938135 19 Left 1180938129 22:19639366-19639388 CCTGGCATAATCATGCTGTTTAT No data
Right 1180938135 22:19639408-19639430 TCTTGGGAGGCCAGGCTGGCTGG No data
1180938129_1180938133 11 Left 1180938129 22:19639366-19639388 CCTGGCATAATCATGCTGTTTAT No data
Right 1180938133 22:19639400-19639422 TTTTGATATCTTGGGAGGCCAGG No data
1180938129_1180938131 3 Left 1180938129 22:19639366-19639388 CCTGGCATAATCATGCTGTTTAT No data
Right 1180938131 22:19639392-19639414 TTATGATGTTTTGATATCTTGGG No data
1180938129_1180938130 2 Left 1180938129 22:19639366-19639388 CCTGGCATAATCATGCTGTTTAT No data
Right 1180938130 22:19639391-19639413 GTTATGATGTTTTGATATCTTGG No data
1180938129_1180938132 6 Left 1180938129 22:19639366-19639388 CCTGGCATAATCATGCTGTTTAT No data
Right 1180938132 22:19639395-19639417 TGATGTTTTGATATCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180938129 Original CRISPR ATAAACAGCATGATTATGCC AGG (reversed) Intergenic
No off target data available for this crispr