ID: 1180938132

View in Genome Browser
Species Human (GRCh38)
Location 22:19639395-19639417
Sequence TGATGTTTTGATATCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180938129_1180938132 6 Left 1180938129 22:19639366-19639388 CCTGGCATAATCATGCTGTTTAT No data
Right 1180938132 22:19639395-19639417 TGATGTTTTGATATCTTGGGAGG No data
1180938128_1180938132 14 Left 1180938128 22:19639358-19639380 CCACTGCACCTGGCATAATCATG No data
Right 1180938132 22:19639395-19639417 TGATGTTTTGATATCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180938132 Original CRISPR TGATGTTTTGATATCTTGGG AGG Intergenic
No off target data available for this crispr