ID: 1180939762

View in Genome Browser
Species Human (GRCh38)
Location 22:19651908-19651930
Sequence CACAGCTAACATCATAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180939756_1180939762 -10 Left 1180939756 22:19651895-19651917 CCATAAAAACCCCCACAGCTAAC No data
Right 1180939762 22:19651908-19651930 CACAGCTAACATCATAATGGTGG No data
1180939755_1180939762 5 Left 1180939755 22:19651880-19651902 CCTGATAAAAGGCATCCATAAAA No data
Right 1180939762 22:19651908-19651930 CACAGCTAACATCATAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180939762 Original CRISPR CACAGCTAACATCATAATGG TGG Intergenic
No off target data available for this crispr