ID: 1180945258

View in Genome Browser
Species Human (GRCh38)
Location 22:19689024-19689046
Sequence GCCTGTGAGCAGAGGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180945258_1180945273 24 Left 1180945258 22:19689024-19689046 CCTGCCACCCTCTGCTCACAGGC No data
Right 1180945273 22:19689071-19689093 TGGCCGGTGGAAAGAGGAGCAGG No data
1180945258_1180945268 4 Left 1180945258 22:19689024-19689046 CCTGCCACCCTCTGCTCACAGGC No data
Right 1180945268 22:19689051-19689073 GGTGTGGGGCATCCAGGAGCTGG No data
1180945258_1180945270 11 Left 1180945258 22:19689024-19689046 CCTGCCACCCTCTGCTCACAGGC No data
Right 1180945270 22:19689058-19689080 GGCATCCAGGAGCTGGCCGGTGG No data
1180945258_1180945267 -2 Left 1180945258 22:19689024-19689046 CCTGCCACCCTCTGCTCACAGGC No data
Right 1180945267 22:19689045-19689067 GCTGCGGGTGTGGGGCATCCAGG No data
1180945258_1180945269 8 Left 1180945258 22:19689024-19689046 CCTGCCACCCTCTGCTCACAGGC No data
Right 1180945269 22:19689055-19689077 TGGGGCATCCAGGAGCTGGCCGG No data
1180945258_1180945266 -10 Left 1180945258 22:19689024-19689046 CCTGCCACCCTCTGCTCACAGGC No data
Right 1180945266 22:19689037-19689059 GCTCACAGGCTGCGGGTGTGGGG No data
1180945258_1180945272 18 Left 1180945258 22:19689024-19689046 CCTGCCACCCTCTGCTCACAGGC No data
Right 1180945272 22:19689065-19689087 AGGAGCTGGCCGGTGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180945258 Original CRISPR GCCTGTGAGCAGAGGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr