ID: 1180945266

View in Genome Browser
Species Human (GRCh38)
Location 22:19689037-19689059
Sequence GCTCACAGGCTGCGGGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180945254_1180945266 -1 Left 1180945254 22:19689015-19689037 CCTCTCCCTCCTGCCACCCTCTG No data
Right 1180945266 22:19689037-19689059 GCTCACAGGCTGCGGGTGTGGGG No data
1180945255_1180945266 -6 Left 1180945255 22:19689020-19689042 CCCTCCTGCCACCCTCTGCTCAC No data
Right 1180945266 22:19689037-19689059 GCTCACAGGCTGCGGGTGTGGGG No data
1180945256_1180945266 -7 Left 1180945256 22:19689021-19689043 CCTCCTGCCACCCTCTGCTCACA No data
Right 1180945266 22:19689037-19689059 GCTCACAGGCTGCGGGTGTGGGG No data
1180945253_1180945266 2 Left 1180945253 22:19689012-19689034 CCTCCTCTCCCTCCTGCCACCCT No data
Right 1180945266 22:19689037-19689059 GCTCACAGGCTGCGGGTGTGGGG No data
1180945258_1180945266 -10 Left 1180945258 22:19689024-19689046 CCTGCCACCCTCTGCTCACAGGC No data
Right 1180945266 22:19689037-19689059 GCTCACAGGCTGCGGGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180945266 Original CRISPR GCTCACAGGCTGCGGGTGTG GGG Intergenic
No off target data available for this crispr