ID: 1180945270

View in Genome Browser
Species Human (GRCh38)
Location 22:19689058-19689080
Sequence GGCATCCAGGAGCTGGCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180945258_1180945270 11 Left 1180945258 22:19689024-19689046 CCTGCCACCCTCTGCTCACAGGC No data
Right 1180945270 22:19689058-19689080 GGCATCCAGGAGCTGGCCGGTGG No data
1180945253_1180945270 23 Left 1180945253 22:19689012-19689034 CCTCCTCTCCCTCCTGCCACCCT No data
Right 1180945270 22:19689058-19689080 GGCATCCAGGAGCTGGCCGGTGG No data
1180945263_1180945270 3 Left 1180945263 22:19689032-19689054 CCTCTGCTCACAGGCTGCGGGTG No data
Right 1180945270 22:19689058-19689080 GGCATCCAGGAGCTGGCCGGTGG No data
1180945262_1180945270 4 Left 1180945262 22:19689031-19689053 CCCTCTGCTCACAGGCTGCGGGT No data
Right 1180945270 22:19689058-19689080 GGCATCCAGGAGCTGGCCGGTGG No data
1180945254_1180945270 20 Left 1180945254 22:19689015-19689037 CCTCTCCCTCCTGCCACCCTCTG No data
Right 1180945270 22:19689058-19689080 GGCATCCAGGAGCTGGCCGGTGG No data
1180945259_1180945270 7 Left 1180945259 22:19689028-19689050 CCACCCTCTGCTCACAGGCTGCG No data
Right 1180945270 22:19689058-19689080 GGCATCCAGGAGCTGGCCGGTGG No data
1180945255_1180945270 15 Left 1180945255 22:19689020-19689042 CCCTCCTGCCACCCTCTGCTCAC No data
Right 1180945270 22:19689058-19689080 GGCATCCAGGAGCTGGCCGGTGG No data
1180945256_1180945270 14 Left 1180945256 22:19689021-19689043 CCTCCTGCCACCCTCTGCTCACA No data
Right 1180945270 22:19689058-19689080 GGCATCCAGGAGCTGGCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180945270 Original CRISPR GGCATCCAGGAGCTGGCCGG TGG Intergenic
No off target data available for this crispr