ID: 1180945273

View in Genome Browser
Species Human (GRCh38)
Location 22:19689071-19689093
Sequence TGGCCGGTGGAAAGAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180945255_1180945273 28 Left 1180945255 22:19689020-19689042 CCCTCCTGCCACCCTCTGCTCAC No data
Right 1180945273 22:19689071-19689093 TGGCCGGTGGAAAGAGGAGCAGG No data
1180945263_1180945273 16 Left 1180945263 22:19689032-19689054 CCTCTGCTCACAGGCTGCGGGTG No data
Right 1180945273 22:19689071-19689093 TGGCCGGTGGAAAGAGGAGCAGG No data
1180945259_1180945273 20 Left 1180945259 22:19689028-19689050 CCACCCTCTGCTCACAGGCTGCG No data
Right 1180945273 22:19689071-19689093 TGGCCGGTGGAAAGAGGAGCAGG No data
1180945258_1180945273 24 Left 1180945258 22:19689024-19689046 CCTGCCACCCTCTGCTCACAGGC No data
Right 1180945273 22:19689071-19689093 TGGCCGGTGGAAAGAGGAGCAGG No data
1180945256_1180945273 27 Left 1180945256 22:19689021-19689043 CCTCCTGCCACCCTCTGCTCACA No data
Right 1180945273 22:19689071-19689093 TGGCCGGTGGAAAGAGGAGCAGG No data
1180945262_1180945273 17 Left 1180945262 22:19689031-19689053 CCCTCTGCTCACAGGCTGCGGGT No data
Right 1180945273 22:19689071-19689093 TGGCCGGTGGAAAGAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180945273 Original CRISPR TGGCCGGTGGAAAGAGGAGC AGG Intergenic
No off target data available for this crispr